Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Inhibin protein for inducing plant to resist disease and accelerate growth and gene sequence

An inhibin and protein technology, applied in plant genetic improvement, genetic engineering, botanical equipment and methods, etc., can solve the problem of no patents or reports on plant immunity inducing plant disease resistance, and achieve sustainable agricultural development, The effect of protecting the ecological environment

Inactive Publication Date: 2008-03-26
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are no reports of filamentous mycostatins at home and abroad, and there are no patents or reports on the use of filamentous fungal inhibins to induce plant disease resistance and improve plant immunity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] This embodiment uses Gateway  Technology, construction of Alternaria tenonella cDNA entry library and expression library.

[0018] Alternaria total RNA was extracted, mRNA was purified; cDNA one-strand synthesis and second-strand synthesis were performed, and cDNA fragments were fractionated by chromatographic column method. AttB1 and attB2 sequences are connected at both ends of the cDNA obtained after fractionation, and are effectively recombined into a plasmid vector containing attP1 and attP2 under the action of BP recombinase. After recombination, the adapters on both sides of the cDNA subcloning become attL, which can be recombined into other vectors through the LR recombination reaction in the λ-att recombination system, so that the library can be directly transferred into other vectors for use without cumbersome subcloning operations. further research. The constructed cDNA entry library was tested, the titer of the entry library reached 6×106, the total libra...

Embodiment 2

[0020] In this example, an immunological method was used to screen the cDNA expression library of Alternaria sp.

[0021] Antibody probes are the basic way to obtain unknown genes, which can be directly used to isolate recombinant clones producing target proteins. Because the gene structure and amino acid sequence of many functional proteins are unknown, nucleic acid probes cannot be used to screen target genes, but antibodies that can specifically bind to expression products can be used to screen genes.

[0022] Rabbits were immunized with the activator protein of Alternaria tenitoides to obtain antibodies to the activator protein; immunological methods were used to screen the cDNA expression library of Alternaria adenaria: firstly, the cDNA expression library to be screened was transferred to a nitrocellulose membrane, and then a Immunoscreening for sexual antibodies. After screening nearly 150,000 clones, 180 suspicious positive spots were obtained. After repeated screenin...

Embodiment 3

[0024] This example is about the expression of phb in Pichia pastoris and the purification of the expressed inhibin protein.

[0025] Use upstream primer P1: 5'GGAATTCATGGCCGCGATACCTACCTC 3' and downstream primer P2: 5'TTGCGGCCGCTGACCTCAGGCCCAACAAGAAG3' to amplify the phb gene by PCR, introduce the EcoRI site into the upstream primer, and introduce the Not I site into the downstream primer; clone after confirmation by sequencing The phb gene was expressed in Pichia pastoris pPIC9K, and then transformed into Pichia pastoris GS115, and the correct transformant was screened out; the expression of the phb gene was induced by methanol, and the expressed inhibin protein was secreted into the culture medium.

[0026] The expressed inhibin protein was isolated and purified using an Akta Explorer protein analyzer. 1ml Hitrap DEAE column on the fermentation broth, eluted step by step gradient, A buffer (20mM Tris-HCl, pH7.5), B buffer (20mM Tris-HCl, pH7.5, 2M NaCl), flow rate 1ml / min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to protein, and features that inhibin gene phb is cloned from the cDNA library of Alternaria tenuissima and expressed in Pichia pastoris and colibacillus and the expressed prohibitin has the functions of antagonizing diseases and promoting the growth of plant.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically clones the inhibin gene (phb) of Alternaria tenuissima by means of molecular biology techniques, and expresses a gene that has disease-resistant and growth-promoting effects on plants. Inhibitin protein (Prohibitin). Background technique [0002] Inhibin gene (phb) is an effective tumor suppressor gene, which is widely distributed in various biological cells such as bacteria, plants, yeast, protozoa and mammals. The inhibitin protein (Prohibitin) encoded by it has a highly conserved structure and multiple functions. It exists on the inner mitochondrial membrane and acts as a molecular chaperone. It also exists in the nucleus and has a negative transcriptional regulatory effect. It plays an important regulatory role in many aspects such as senescence and apoptosis. The naming of inhibin is derived from historical reasons. Only one function of these multifunctional proteins was ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C07K14/195C12N15/63
Inventor 邱德文曾洪梅杨秀芬刘峥张宁董健伸赵明治刘文平袁京京
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com