Inhibin protein for inducing plant to resist disease and accelerate growth and gene sequence
An inhibin and protein technology, applied in plant genetic improvement, genetic engineering, botanical equipment and methods, etc., can solve the problem of no patents or reports on plant immunity inducing plant disease resistance, and achieve sustainable agricultural development, The effect of protecting the ecological environment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0017] This embodiment uses Gateway Technology, construction of Alternaria tenonella cDNA entry library and expression library.
[0018] Alternaria total RNA was extracted, mRNA was purified; cDNA one-strand synthesis and second-strand synthesis were performed, and cDNA fragments were fractionated by chromatographic column method. AttB1 and attB2 sequences are connected at both ends of the cDNA obtained after fractionation, and are effectively recombined into a plasmid vector containing attP1 and attP2 under the action of BP recombinase. After recombination, the adapters on both sides of the cDNA subcloning become attL, which can be recombined into other vectors through the LR recombination reaction in the λ-att recombination system, so that the library can be directly transferred into other vectors for use without cumbersome subcloning operations. further research. The constructed cDNA entry library was tested, the titer of the entry library reached 6×106, the total libra...
Embodiment 2
[0020] In this example, an immunological method was used to screen the cDNA expression library of Alternaria sp.
[0021] Antibody probes are the basic way to obtain unknown genes, which can be directly used to isolate recombinant clones producing target proteins. Because the gene structure and amino acid sequence of many functional proteins are unknown, nucleic acid probes cannot be used to screen target genes, but antibodies that can specifically bind to expression products can be used to screen genes.
[0022] Rabbits were immunized with the activator protein of Alternaria tenitoides to obtain antibodies to the activator protein; immunological methods were used to screen the cDNA expression library of Alternaria adenaria: firstly, the cDNA expression library to be screened was transferred to a nitrocellulose membrane, and then a Immunoscreening for sexual antibodies. After screening nearly 150,000 clones, 180 suspicious positive spots were obtained. After repeated screenin...
Embodiment 3
[0024] This example is about the expression of phb in Pichia pastoris and the purification of the expressed inhibin protein.
[0025] Use upstream primer P1: 5'GGAATTCATGGCCGCGATACCTACCTC 3' and downstream primer P2: 5'TTGCGGCCGCTGACCTCAGGCCCAACAAGAAG3' to amplify the phb gene by PCR, introduce the EcoRI site into the upstream primer, and introduce the Not I site into the downstream primer; clone after confirmation by sequencing The phb gene was expressed in Pichia pastoris pPIC9K, and then transformed into Pichia pastoris GS115, and the correct transformant was screened out; the expression of the phb gene was induced by methanol, and the expressed inhibin protein was secreted into the culture medium.
[0026] The expressed inhibin protein was isolated and purified using an Akta Explorer protein analyzer. 1ml Hitrap DEAE column on the fermentation broth, eluted step by step gradient, A buffer (20mM Tris-HCl, pH7.5), B buffer (20mM Tris-HCl, pH7.5, 2M NaCl), flow rate 1ml / min...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com