Method for preparing dissolvable high activity recombinant human epidermal growth factor

A high-activity technology of epidermal growth factor, applied in the field of preparation of soluble high-activity recombinant human epidermal growth factor, can solve the problems of low yield and activity, low purity of human epidermal growth factor, etc., and achieve simple production process and simplified purification steps , The effect of stable product quality

Active Publication Date: 2009-01-28
SHANXI JINBO BIO PHARMA CO LTD
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the problems that the existing chemical synthesis method and biological extraction method have different shortcomings and the human epidermal growth factor obtained by gene recombination method has low purity, low yield and low activity, a preparation method is provided. Method for dissolving highly active recombinant human epidermal growth factor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing dissolvable high activity recombinant human epidermal growth factor
  • Method for preparing dissolvable high activity recombinant human epidermal growth factor
  • Method for preparing dissolvable high activity recombinant human epidermal growth factor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Embodiment one: Construction and expression of hEGF gene expression vector:

[0018] The full-length sequence of human epidermal growth factor (hEGF) is as follows:

[0019] AATAGTGACTCTGAATGTCCCCTGTCCCACGATGGGTACTGCCTCCATGATGGTGTGTGCATGTATATTGAAGCATTGGACAAGTATGCATGCAACTGTGTTGTTGGCTACATCGGGGAGCGATGTCAGTACCGAGACCTGAAGTGGTGGGAACTGCGC

[0020] And replace the codons unfavorably expressed in E. coli to obtain the optimized gene sequence nhEGF:

[0021] AACTCAGATTCCGAATGTCCGCTGTCGCATGATGGGTACTGCCTGCATGATGGTGTCTGCATGTACATCGAAGCGCTGGATAAATATGCCTGCAATTGTGTCGTGGGTTACATCGGGGAACGCTGCCAATATCGTGATCTGAAATGGTGGGAATTGCGC

[0022] Design a complete set of primers for the nhEGF sequence, all arranged from 5`-3` as follows:

[0023] hEGF-P1: GCATGATGGGTACTGCCTGCATGATGGTGTCTGCATGTACATCGAAGCGCTGGAT

[0024] hEGF-P2: TTCCCCGATGTAACCCACGACACAATTGCAGGCATATTTATCCAGCGCTTCGATG

[0025] hEGF-P3: CAT GGATCC AACTCAGATTCCGAATGTCCGCTGTCGCATGATGGGTACTGCCTGC

[0026]hEGF-P4: GCGCAATTCCCACCCATTTCAGA...

Embodiment 2

[0067] Example 2: Using the hEGF stock solution obtained above to prepare EGF fine products after purification

[0068] In the high concentration solution containing hEGF, adjust its pH value to 7.0-8.0. Prepare loading buffer:

[0069] MCAC-15MCAC-1000

[0070] 20mM Tris hydrochloride pH10.0 20mM Tris hydrochloride pH10.0

[0071] 0.5M NaCl 0.5M NaCl

[0072] 10% (v / v) glycerin (adjustable to 20%) 10% (v / v) glycerin

[0073] 15mMol / L imidazole 1M imidazole

[0074] Wash the Ni-NTA His-Bind Resin column material with MCAC-15 solution, then co-incubate the column material with hEGF solution, and shake gently at room temperature (preferably on ice) for 30 min. Then put it on the column, use MCAC-50 to elute the impurity protein, and finally use MCAC-300 to elute the target protein. The resulting product was dialyzed overnight to obtain high-purity hEGF fine product. The product can be used for further processing into finished products.

Embodiment 3

[0075] Embodiment three: the identification of the refined EGF after purification

[0076] First use SDS-PAGE to identify the concentration of the expression product:

[0077] Sample treatment solution: SDS 1g, Glycerol 5mL, bromophenol blue (BPB) solid trace, dithiothreitol (DDT) 2.5mL, solution B 25mL, add deionized water to 50mL;

[0078] Take 10ul of the digested hEGF solution, add 2ul of sample treatment solution, place in a boiling water bath for 5 minutes, and apply a sample volume of 5ul / well. The standard protein molecular weight was treated in the same way, stained with Coomassie brilliant blue R-250, and then the concentration was identified by SDS-PAGE. The result is as Figure 4 As shown, the leftmost lane is the standard protein molecular weight control, and the right two lanes are hEGF products refined and purified at different times, showing the purity and concentration of the samples.

[0079] Activity identification of expression products:

[0080]The in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene recombination, in particular to a method for preparing soluble and high-activity recombinant human epidermal growth factor; the invention solves the problems that the human epidermal growth factor which is obtained by using the chemical synthesis method and the biological extraction method which have different self-defects respectively and by using the gene recombination method has lower purify and low yield and activity, and comprises the following steps of: constructing the gene cloning of the human epidermal growth factor, replacing codons which are not beneficial to be expressed by Escherichia coli to obtain optimized gene sequence, adding molecular chaperone of PDI to help target gene to be expressed effectively in Escherichia coli, and embedding HIS label and enzyme cutting site of protein in the sequence to help the target gene to be purified effectively, and the identification of biological activity; the obtained human epidermal growth factor has high purify, high yield, high activity, low cost, simple production technique and stable product quality; the product can be used for manufacturing drugs or articles for beauty and cosmetics and is beneficial to be promoted to the public.

Description

technical field [0001] The invention relates to the technical field of gene recombination, in particular to a method for preparing soluble highly active recombinant human epidermal growth factor. Background technique [0002] Human epidermal growth factor (hEGF) is a growth factor that was isolated and identified earlier. It is named for its ability to promote epidermal thickening and keratinization. It is a heat-resistant single-chain low-molecular-weight polypeptide consisting of 53 amino acids and a molecular weight of 5400 Da. The three-dimensional structure has been solved. In the human body, it is mainly secreted by the submandibular glands, kidneys, pancreas, duodenum and other glands, and exists in almost all body fluids, secretions and most tissues. [0003] As a powerful cell division promoting factor, hEGF has a variety of biological activities, which are divided into the following aspects: 1. Promoting cell proliferation. hEGF is a broad-spectrum mitogen, which...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/70C07K14/485C07K1/14
Inventor杨霞
OwnerSHANXI JINBO BIO PHARMA CO LTD