Rapid diagnosis reagent kit and detection method for campylobacter jejuni gene
A technology for rapid diagnosis of Campylobacter jejuni, applied in biochemical equipment and methods, measurement/testing of microorganisms, resistance to vector-borne diseases, etc. Achieve the effects of intuitive and clear identification results, high yield, and low detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0036] The preparation of embodiment 1 kit
[0037] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0038] Outer primer F3: GAAGCGCTTTTTGGTTCTT;
[0039] Outer primer B3: GGTATTACTCAAGGTATGATGTG;
[0040] Internal primer FIP: GGTGGATTGTTGTATCTTATCGGTTttttTATCAAGCACTCTTCCACAAG;
[0041] Internal primer BIP: ATAAGGAACAATAGCCACAACAGTttttGCGACAGATGAGTATGGTAAC;
[0042](2) Purchase DNA polymerase: Bst DNApolymerase (large fragment) and place it in a container.
[0043] (3) Preparation of reaction solution: The formula of the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, 2 mol each of primers FIP / BIP and 0.25 mol each of outer primers F3 / B3 were prepared and placed in containers.
[0044] (4) Preparation of sample pretreatment solution: the formula of sample pretreatment solution was prepared by cont...
Embodiment 2
[0055] The preparation of embodiment 2 kit
[0056] The formula of the reaction solution is: each 1L reaction solution contains 1.6mmol dNTP, 20mmol Tris-HCl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, internal primer FIP / BIP each 1.6 mol and 0.2mol each of outer primer F3 / B3;
[0057] The formula of the sample pretreatment solution is: every 1L of the sample pretreatment solution contains 10mmol of Tris-HCl with pH8.0, 1mmol of EDTA and 10ml of Triton X-100.
[0058] The chromogenic solution is EvaGreen.
[0059] Others are the same as embodiment 1.
Embodiment 3
[0060] Example 3 Application of Campylobacter jejuni Gene Rapid Diagnostic Kit
[0061] 1. Sample processing (template DNA extraction)
[0062] (1) Take a sample of about 25 mg / ml using aseptic technique;
[0063] (2) Carry out bacterial enrichment treatment according to the national standard GB / T4789.9-2003;
[0064] (3) Take 1ml of enrichment suspension and centrifuge at 10,000rpm for 2min to obtain bacterial sediment;
[0065] (4) Add 100 μl of sample pretreatment solution to the above-mentioned cell pellet and mix evenly, boil in boiling water for 10 minutes, immediately place on ice to cool for 10 minutes, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is the sample template DNA.
[0066] 2. The reaction process of loop-mediated isothermal amplification technology
[0067] 1) Prepare a reaction system in a 200 μl reaction tube: 22 μl of reaction solution, 0.5 μl of Bst DNA polymerase (4U), and 2.5 μl of template DNA.
[0068] 2) React the prepared reactio...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com