Rapid diagnosis reagent kit and detection method for staphylococcus epidermidis gene
A technology for rapid diagnosis of Staphylococcus epidermidis, which is applied in the directions of biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as the genetic rapid diagnosis kit for detecting Staphylococcus epidermidis, etc., and achieves significant color difference, High specificity, rapid amplification effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0034] The preparation of embodiment 1 kit
[0035] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0036] Outer primer F3: CTAAAACWGCAACATTAGGAAAT;
[0037] Outer primer B3: AGATACTTTGCTAGCAACTTGT;
[0038] Internal primer FIP: AGCAGTGTTATAAACAACATCACCTTTTTTATTTAGTTGAAGACTACAATAGCG;
[0039] Internal primer BIP: AARGCACCAGTAAAAGTGAATCATTTTTTTGGTGTACCCCCAAGGA;
[0040] (2) Purchase DNA polymerase: Bst DNApolymerase (large fragment) and place it in a container.
[0041](3) Preparation of reaction solution: The formula of the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, 2 mol each of primers FIP / BIP and 0.25 mol each of outer primers F3 / B3 were prepared and placed in containers.
[0042] (4) Preparation of sample pretreatment solution: the formula of sample pretreatment solution was prepared by ...
Embodiment 2
[0053] The preparation of embodiment 2 kit
[0054] The formula of the reaction solution is: each 1L reaction solution contains 1.6mmol dNTP, 20mmol Tris-HCl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, internal primer FIP / BIP each 1.6 mol and 0.2mol each of outer primer F3 / B3;
[0055] The formula of the sample pretreatment solution is: every 1L of the sample pretreatment solution contains 10mmol of Tris-HCl with pH8.0, 1mmol of EDTA and 10ml of Triton X-100.
[0056] The chromogenic solution is EvaGreen.
[0057] Others are the same as embodiment 1.
Embodiment 3
[0058] Application of embodiment 3 Staphylococcus epidermidis gene rapid diagnostic kit
[0059] 1. Sample processing (template DNA extraction)
[0060] (1) Take the secretion sample with a cotton swab in aseptic technique, and rinse it in about 10ml of normal saline;
[0061] (2) Take 5ml of the eluted sample solution and centrifuge at 10,000rpm for 2min to obtain bacterial cell precipitation;
[0062] (3) Add 100 μl of sample pretreatment solution to the above cell pellet and mix evenly, boil in boiling water for 10 minutes, immediately place on ice to cool for 10 minutes, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is the sample template DNA.
[0063] 2. The reaction process of loop-mediated isothermal amplification technology
[0064] 1) Prepare a reaction system in a 200 μl reaction tube: 22 μl of reaction solution, 0.5 μl of Bst DNA polymerase (4U), and 2.5 μl of template DNA.
[0065] 2) React the prepared reaction tube at a constant temperature of 64...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com