Dioxin detection apparatus and detection method

A detection device and detection method technology, applied in the direction of measuring devices, biological testing, material inspection products, etc., can solve the problems of expensive and complex detection mode of gold electrode electrochemical instrument, difficult product commercialization, AHR loss, etc.

Active Publication Date: 2013-05-15
DEV CENT FOR BIOTECHNOLOGY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This system not only requires an extremely short action time (<5min), but also has a very simple structure and is easy to operate. Unfortunately, the sensitivity of the system is still not enough, and there is a problem of AHR loss. Furthermore, the gold electrode itself and the electrochemical The instrument detection mode is too expensive and complicated, resulting in high difficulty in product commercialization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dioxin detection apparatus and detection method
  • Dioxin detection apparatus and detection method
  • Dioxin detection apparatus and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1 preparation of aromatic hydrocarbon acceptor

[0048] The culture medium and buffer used in this embodiment are as follows:

[0049] (1) Medium used for protein expression, LB medium, Ampicillin (Amp) (final concentration 100 μg / ml), chloramphenicol (Cm) (final concentration 34 μg / ml).

[0050] (2) LB medium: tryptone (Tryptone) 10g / L, yeast extract 5g / L, NaCl 10g / L.

[0051] (3) GST washing / binding buffer: 140mM NaCl, 10mMNa 2 HPO 4 , 1.8mM KH 2 PO 4 , 2.7mM KCl, 0.1mM PMSF, pH7.3.

[0052] (4) GST elution buffer: 50 mM Tris-HCl, 10 mM reduced glutathione (glutathione), 0.1 mM PMSF, pH 8.0.

[0053] (5) 6X Loading buffer: 300 mM Tris-HCl, pH 6.8, 12% SDS, 0.6% Bromophenol blue, 60% glycerol, 6% β-mercaptoethanol.

[0054] (6) SDS-PAGE running buffer: 25 mM Tris-HCl, pH 8.3, 250 mM glycine, 0.1% SDS.

[0055] (7) Aryl hydrocarbon receptor storage buffer: 50 mM Tris-HCl, pH 7.4, 500 mM NaCl, 1 mM DTT, 0.1% NP-40, 0.1 mM PMSF.

[0056] (a) Cloning th...

Embodiment 2

[0064] Example 2 Preparation of Aryl Hydrocarbon Receptor Nuclear Translocation Protein

[0065] This implementation was carried out with the medium and buffer used in Example 1.

[0066] (a) Cloning the DNA of the aryl hydrocarbon receptor nuclear translocation protein and the aryl hydrocarbon receptor binding region into the vector pGEX-4T1

[0067] According to the NCBI website ( http: / / www.ncbi.nlm.nih.gov / index .btml) to design primers for the ligand-binding fragment of the aryl hydrocarbon receptor nuclear translocator protein in the literature on mouse liver aryl hydrocarbon receptor nuclear translocator gene mRNA. The primers were designed as follows: Forward primer (Forword primer): 5'GGAACTGGCAACACATCTACT3', located at nucleotide 486-506 of the gene sequence, reverse primer (Reverseprimer): 5'TGTAGGCCGTGGTTCCTGGCT3', located at 1458th nucleotide of the gene sequence Nucleotide-1478 nucleotides, then using the total mouse liver RNA as a template, use reverse transc...

Embodiment 3

[0073] The preparation of embodiment 3 detection device test piece

[0074] In this embodiment, a screen printing electrode (SPE; purchased from Taibo (Qiaoying) Technology Co., Ltd.) is used to prepare the detection device of the present invention. The structure of the detection device 100 is as shown in Figure 1, including a PVC material substrate 102; A reference electrode 104, which is located on the substrate 102; a working electrode 106, which is located on the substrate 102 and not in contact with the reference electrode 104; a working area 108, which is located on the working electrode 106; and a PVC insulation Layer 110. The base material of the screen printing electrode is made of PVC, and the screen printing carbon glue is divided into three procedures. First, the silver glue is applied to the area other than the working area 108, and then the first and second layers of the working area 108 are screened with pure carbon glue. The third layer is printed with an appr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a dioxin detection device and device method thereof. The method is based on biological affinity and comprises the following steps: contacting the detection device with the sample containing dioxin or dioxin-like material; generating a screening effect on the electrode surface using a biological identification element on the detection device and the affinity between the dioxin or dioxin-like material; measuring the current signal difference between the post-testing current signal and the before-testing current signal and comparing the standard solution containing the dioxin or dioxin-like material with the corresponding current signal difference, thereby determining the concentration of the dioxin or dioxin-like material in sample.

Description

technical field [0001] The invention relates to a dioxin detection method and a detection device used therefor, in particular to a simple, fast, on-site electrochemical dioxin detection device and a dioxin detection method using the same. Background technique [0002] Dioxin is known as the poison of the century because of its acute toxicity. Most of the lesions or physiological abnormalities caused by human exposure to dioxin are very small exposures. According to literature records, the toxicity of dioxin includes skin toxicity, nervous system toxicity, liver toxicity, tumor, reproductive system toxicity and so on. Sources of dioxin include natural generation (such as volcanic eruptions, forest fires), by-products of industrial raw material preparation processes (such as chlorophenol compounds), combustion emissions from specific industrial preparation processes (industrial high-temperature preparation processes, chemical manufacturing, electricity and Energy utilization)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N27/42G01N27/327G01N33/53
Inventor巫鸿章刘照国林诗凯卢劲汎蔡士昌魏琨洲林毕修平
OwnerDEV CENT FOR BIOTECHNOLOGY