Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing human growth hormone recombinant

A technology of human growth hormone and solution, which is applied in the direction of preparation methods of growth hormone and peptides, methods based on microorganisms, etc., can solve the problems of low activity and low purity of human growth hormone, and achieve simplified purification process, high application value, rapid The effect of efficient separation

Active Publication Date: 2012-05-30
杨霞
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention provides a method for preparing recombinant human growth hormone in order to solve the problems that existing methods for expressing recombinant human growth hormone using Escherichia coli have different shortcomings and the obtained human growth hormone has low activity and low purity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing human growth hormone recombinant
  • Method for preparing human growth hormone recombinant
  • Method for preparing human growth hormone recombinant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1: Construction and expression of nHGH gene expression vector:

[0020] 1) Construction of an alternate vector for pET-21b-PDI-pp

[0021] Design primers for PDI, including restriction sites, arranged from 5`-3` as follows:

[0022] PDI-S: GAGATATA CATATG GACGCCCCAGAGGAGGAGGACC

[0023] PDI-a: GCG GGATCC GGGCCCCTGGAACAGAACTTCCAG

[0024] CAGTTCATCTTTCAC

[0025] Primers were diluted to 50 pmol / ul, followed by a PCR step.

[0026] PCR reaction system 50ul:

[0027] wxya 2 O: 40ul

[0028] 10*PCR BUFFER 5ul

[0029] dNTP 1ul

[0030] Template: 1ul

[0031] Up / down stream primers: 1ul

[0032] pfu enzyme 1ul

[0033] PCR reaction conditions (Tag enzyme):

[0034] 94℃ 8min

[0035] 94°C 30s

[0036]65℃ 30s

[0037] 72℃ 1min 30 cycles

[0038] 72°C 10min

[0039] The PDI band was detected by agarose gel electrophoresis at about 1600bp. The target gene was recovered from the gel, and the cohesive end was cut with Nde I and BamH I. The pET-21b vecto...

Embodiment 2

[0067] Example 2: Purification of protein from nHGH stock solution

[0068] In high concentrations containing HIS 6 -FX-nHGH or HGH protein solution, adjust its pH value to 8.0. Prepare loading buffer:

[0069] MCAC-15MCAC-1000

[0070] 20mM Tris hydrochloride pH10.0 20mM Tris hydrochloride pH10.0

[0071] 0.5M NaCl 0.5M NaCl

[0072] 10% (v / v) glycerin (adjustable to 20%) 10% (v / v) glycerin

[0073] 15mMol / L imidazole 1M imidazole

[0074] Wash the nickel ion affinity column (Ni-NTA His-Bind Resin) column with MCAC-15 solution, then incubate the column with nHGH solution, shake gently at room temperature (preferably on ice) for 30 minutes. Then put on the column, use MCAC-60 to elute the impurity protein, and finally use MCAC-250 to elute the target protein. The resulting product was dialyzed overnight to obtain high-purity HIS 6 -FX-nHGH Boutique or HGH Boutique.

Embodiment 3

[0075] Embodiment three: identification of HGH high-quality goods after purification

[0076] First use SDS-PAGE to identify the concentration of the expression product:

[0077] Sample treatment solution: SDS 1g, Glycerol 5mL, bromophenol blue (BPB) solid trace, dithiothreitol (DDT) 2.5mL, solution B 25mL, add deionized water to 50mL

[0078] Take 10ul of nHGH solution after digestion, add 2ul of sample treatment solution, and place in boiling water bath for 5 minutes. The sample volume is 5ul / well. Standard protein molecular weights were treated similarly. Stain with Coomassie Brilliant Blue R-250. Such as Figure 4 As shown, SDS-PAGE analysis and activity detection were carried out, the leftmost line is the protein molecular weight control, and the middle is HIS 6 -FX-nHGH sample, the right side is the HGH sample after final digestion. Preliminary identification of the type of protein extracted.

[0079] Identification of expression products:

[0080] Human growth h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene recombination, in particular to a method for preparing recombinant human growth hormone, which solves the problems that all traditional methods for using colon bacillus to express recombinant human growth hormone have defects, and obtained human growth hormone have low activity, low purity and the like. The method comprises the following steps of: constructing a human growth hormone gene for cloning, and replacing codons of colon bacillus, which are unfavorable to expression, to obtain an optimized gene sequence; then, adding the molecular chaperone of PDI to help a target gene to efficiently express, inserting an HIS label and a prolease cutting site to help efficiently purify interest protein; and finally, utilizing Factor Xa prolease to remove the HIS label and expose the original amino terminal, so that the recombinant human growth hormone can not produce antibodies in human bodies. The obtained recombinant human growth hormone has high purity, high yield, low cost, simple production technology and stable quality.

Description

technical field [0001] The invention relates to the technical field of gene recombination, in particular to a method for preparing recombinant human growth hormone. Background technique [0002] Human growth hormone (HGH), also known as somatotorpin, is a hydrophilic single chain globulin composed of 191 amino acids, its relative molecular mass is about 22kD, and its isoelectric point P1 is 4.9. There are two pairs of disulfide bonds in the molecule. Human growth hormone is an important non-glycosylated protein hormone secreted by eosinophils in the anterior pituitary gland of the human brain. Under the stimulation of the hypothalamic growth hormone releasing factor, the pituitary gland can release growth hormone, while somatostatin can inhibit its release. HGH receptors throughout the human body. The mechanism of action of HGH is generally considered to be through cAMP. After binding to specific receptors on the target cell membrane, it changes the transport of amino aci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12P21/02C07K14/61C07K1/36C07K1/34C07K1/22C12R1/19
Inventor 杨霞
Owner 杨霞
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More