Pichia pastoris engineering bacteria of surface display candida antarctica lipase B (CALB) and method for catalyzing and synthesizing short-chain aromatic ester

A Pichia pastoris, surface display technology, which is applied in the field of whole-cell enzyme preparations to efficiently catalyze the synthesis of short-chain aromatic esters, can solve the problems of high cost, long production cycle, shortened reaction cycle, etc., and achieves short reaction time and reduced production cost. , the effect of high yield

Active Publication Date: 2010-08-04
SOUTH CHINA UNIV OF TECH
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Chinese invention patent CN1223300 discloses a method of microbial lipase enzymatic synthesis of ester, the enzyme used is the self-produced Rhizopus sinica lipase or commercial immobilized enzyme Lypozyme IM lipase, the catalytic reaction tim

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0025] Example 1

[0026] Production of Pichia whole-cell enzyme preparation displaying Candida antarctica lipase B on the surface.

[0027] First, the primers were designed according to the nucleotide sequence of the Candida antarctic lipase (calb) gene LF058 (upstream primer is 5'TGTAGAATTCCTGCCTTCCGGTTCGGACCCTG 3', and EcoR I restriction site is introduced, and the downstream primer 5'GAGGCCGTAGCAGTGGGGATGCGCATAGAGCTCAGGTCCTCCACGAG 3', introduced Mlu I restriction site). Using Candida antarctica genomic DNA as a template for PCR amplification of full-length calb, the PCR procedure is as follows: 95°C pre-denaturation for 5 minutes, 94°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute for 30 cycles, and 72°C for 10 minutes of extension.

[0028] Secondly, design primers according to the nucleotide sequence of α lectin. The upstream primer is 5'CTCCGGCATCGTCACCCCTACGCGTATCTCGAGTCCAGGAGGTGCTC 3', which introduces the 19bp and MluI restriction site at the downstream end of CALB ge...

Example Embodiment

[0031] Example 2

[0032] Using acetic acid and ethanol as substrates, whole-cell enzyme preparations catalyze the non-aqueous phase esterification reaction to prepare ethyl acetate.

[0033] Reagents are used in advance The molecular sieve fully removes water. Add absolute ethanol and glacial acetic acid to n-heptane. After the addition, the concentration of absolute ethanol is 0.5 mol / L, and the concentration of glacial acetic acid is 0.4 mol / L. Take 10mL of the substrate (including 288.6μL of glacial acetic acid, 291.2μL of absolute ethanol, 9420.2μL of n-heptane, and the molar ratio of acid to alcohol is 1:1.25) and place the mixture in a 50mL Erlenmeyer flask with stopper, and add the content of 30g / L to the example 1. The prepared lyophilized bacterial powder, the reaction temperature is 40℃, and the reaction is shaken at 200rpm. After 0.5h, 0.6g molecular sieve is added and reacted for 3h. The conversion rate of acetic acid can reach 92.1%. The reaction time is only a rep...

Example Embodiment

[0034] Example 3

[0035] Using butyric acid and isoamyl alcohol as substrates, whole-cell enzyme preparation catalyzes the non-aqueous phase esterification reaction to prepare isoamyl butyrate.

[0036] Reagents are used in advance The molecular sieve fully removes water. Add isoamyl alcohol and butyric acid to n-heptane. After the addition, the concentration of isoamyl alcohol is 0.88 mol / L, and the concentration of butyric acid is 0.8 mol / L. Take 10 mL of the substrate (of which 734.3 μL of butyric acid, 957.7 μL of isoamyl alcohol, 8308 μL of n-heptane, and the molar ratio of acid to alcohol is 1:1.1) and place the mixture in a 50 mL Erlenmeyer flask with stopper, and add the content of Example 1 with a content of 20 g / L The prepared freeze-dried bacterial powder, the reaction temperature is 50 ℃, and then the reaction is shaken at 200 rpm. After 0.5 h, 0.6 g molecular sieve is added, and the reaction is 3 h. The conversion rate of butyric acid can reach 97%, as reported by ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses Pichia pastoris engineering bacteria of surface display candida antarctica lipase B (CALB) and a method for catalyzing and synthesizing short-chain aromatic ester. The method comprises the following steps of: fermenting a bacterial strain shake flask of the Pichia pastoris engineering bacteria of the surface display CALB to gain thalli; freezing and drying in vacuum for above 24h to prepare a whole-cell enzyme preparation; carrying out esterification reaction to obtain a short-chain aromatic ester product by adopting short-chain acid and short-chain alcohol as raw materials, the whole-cell enzyme preparation as a catalyst and liquid which can dissolve the short-chain acid and the short-chain alcohol as a solvent, wherein the temperature of the esterification reaction is 20-60 DEG C, the consistency of the whole-cell enzyme preparation of a reactant in a reaction system is 10-40g/L, and the reaction time is 1-6h. Compared with the prior report, the method greatly shortens the reaction time, has a productive rate as high as 98 percent and high continuous operating stability, can recycle the whole-cell catalyst which is centrifugally recovered after the reaction and greatly reduce production cost.

Description

technical field [0001] The invention relates to a gene expression vector capable of displaying Candida antarctica lipase B on the surface of Pichia pastoris and a Pichia engineered bacterium displaying high-activity lipase, in particular to a whole-cell enzyme preparation Efficient catalytic synthesis of short-chain aromatic esters. Background technique [0002] Most of the short-chain aromatic esters have edible fruit flavor, such as ethyl caproate, ethyl propionate, ethyl butyrate, etc. These short-chain esters are not only important components of flavors and fragrances, but also used as major food additives in the food, beverage, and brewing industries. The annual output of ethyl caproate in my country alone reaches more than 2,000 tons, with an output value of hundreds of millions. Yuan. These ester flavors currently used in production are mainly synthesized by chemical methods in the presence of inorganic catalysts. The production process often involves high temperatur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/19C12P7/62C12R1/84
CPCY02P20/584
Inventor 林影韩双艳金子黄登峰郑穗平
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap