Pichia pastoris engineering bacteria of surface display candida antarctica lipase B (CALB) and method for catalyzing and synthesizing short-chain aromatic ester

[0025] Example 1

[0026] Production of Pichia whole-cell enzyme preparation displaying Candida antarctica lipase B on the surface.

[0027] First, the primers were designed according to the nucleotide sequence of the Candida antarctic lipase (calb) gene LF058 (upstream primer is 5'TGTAGAATTCCTGCCTTCCGGTTCGGACCCTG 3', and EcoR I restriction site is introduced, and the downstream primer 5'GAGGCCGTAGCAGTGGGGATGCGCATAGAGCTCAGGTCCTCCACGAG 3', introduced Mlu I restriction site). Using Candida antarctica genomic DNA as a template for PCR amplification of full-length calb, the PCR procedure is as follows: 95°C pre-denaturation for 5 minutes, 94°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute for 30 cycles, and 72°C for 10 minutes of extension.

[0028] Secondly, design primers according to the nucleotide sequence of α lectin. The upstream primer is 5'CTCCGGCATCGTCACCCCTACGCGTATCTCGAGTCCAGGAGGTGCTC 3', which introduces the 19bp and MluI restriction site at the downstream end of CALB gene, and the downstream primer is 5'ATTAGCGGCCGCTTAGAATAGCAGGTACGACAAAAG 3', which introduces Not I restriction enzyme digestion. Site. Using the recombinant plasmid containing α lectin as a template for PCR amplification of α lectin. The PCR program is as follows: pre-denaturation at 94°C for 5 min, 30 cycles at 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min, and extension at 72°C for 10 min.

[0029] 1μL of the above two PCR products were taken as a template and added to the new PCR system to amplify the CALB-NS fusion gene fragment (upstream primer used to amplify the upstream primer of CALB: 5'TGTAGAATTCCTGCCTTCCGGTTCGGACCCTG 3', downstream primer used to amplify the downstream of α lectin Primer: 5'ATTAGCGGCCGCTTAGAATAGCAGGTACGACAAAAG 3'). The PCR program is as follows: pre-denaturation at 94°C for 5 min, 30 cycles at 95°C for 1 min, 55°C for 1.5 min, and 72°C for 2 min, and extension at 72°C for 10 min. The fusion gene product was purified and digested with Eco RI and Not I. At the same time, 20 μL plasmid pPIC9K was digested with Eco RI and Not I. After purification, it was digested with T 4 DNA ligase ligation, transformation of E. coli Top10, selection of positive transformants.

[0030] The verified recombinant plasmid pKNS-CALB was linearized by Sac I and transformed into P.pastoris GS115 by electrotransfer. The transformant was coated on the G418 gradient plate and incubated at 30°C for 2 days. Part of the transformants resistant to high concentration of G418 were selected and inoculated into 5ml YPD culture medium, incubated overnight at 30°C and 250r/min, and the lipase activity was detected by alkaline titration to obtain a Pichia pastoris engineered strain (Pichia pastoris GS115/ pKNS-CALB), this strain was deposited in the China Type Culture Collection on September 30, 2009, the deposit number is: CCTCC NO: M 209217, and the deposit address is Wuhan University, Wuhan City, Hubei Province (Zip code 430072). The engineering strain of Pichia pastoris was first cultivated with YPD seed solution and then expanded by BMGY for 24 hours; the bacteria were collected by centrifugation at 6000g at room temperature. Then use the same volume of BMMY to induce culture, and add methanol every 24h to a final concentration of 1%. Incubate on a shaker at 30°C and 250 rpm for 4 days. Centrifuge at 7000 rpm and 4°C for 10 minutes, discard the supernatant, wash the cells three times with deionized water, and then resuspend the cells and freeze-dry them in a vacuum for 24 hours to obtain freeze-dried cells.

[0031] Example 2

[0032] Using acetic acid and ethanol as substrates, whole-cell enzyme preparations catalyze the non-aqueous phase esterification reaction to prepare ethyl acetate.

[0033] Reagents are used in advance The molecular sieve fully removes water. Add absolute ethanol and glacial acetic acid to n-heptane. After the addition, the concentration of absolute ethanol is 0.5 mol/L, and the concentration of glacial acetic acid is 0.4 mol/L. Take 10mL of the substrate (including 288.6μL of glacial acetic acid, 291.2μL of absolute ethanol, 9420.2μL of n-heptane, and the molar ratio of acid to alcohol is 1:1.25) and place the mixture in a 50mL Erlenmeyer flask with stopper, and add the content of 30g/L to the example 1. The prepared lyophilized bacterial powder, the reaction temperature is 40℃, and the reaction is shaken at 200rpm. After 0.5h, 0.6g molecular sieve is added and reacted for 3h. The conversion rate of acetic acid can reach 92.1%. The reaction time is only a report that the yield is close. 1/26 of that.

[0034] Example 3

[0035] Using butyric acid and isoamyl alcohol as substrates, whole-cell enzyme preparation catalyzes the non-aqueous phase esterification reaction to prepare isoamyl butyrate.

[0036] Reagents are used in advance The molecular sieve fully removes water. Add isoamyl alcohol and butyric acid to n-heptane. After the addition, the concentration of isoamyl alcohol is 0.88 mol/L, and the concentration of butyric acid is 0.8 mol/L. Take 10 mL of the substrate (of which 734.3 μL of butyric acid, 957.7 μL of isoamyl alcohol, 8308 μL of n-heptane, and the molar ratio of acid to alcohol is 1:1.1) and place the mixture in a 50 mL Erlenmeyer flask with stopper, and add the content of Example 1 with a content of 20 g/L The prepared freeze-dried bacterial powder, the reaction temperature is 50 ℃, and then the reaction is shaken at 200 rpm. After 0.5 h, 0.6 g molecular sieve is added, and the reaction is 3 h. The conversion rate of butyric acid can reach 97%, as reported by Yang Benhong (Yang Benhong. Non-aqueous Phase lipase-catalyzed synthesis of isoamyl butyrate. Compared with the lipase-catalyzed synthesis of isoamyl butyrate produced by Rhizopus PW358 of China Food Additives, 2005, 5:74-79) through solid-state fermentation, the reaction time is shortened by 2h .