Pichia pastoris engineered bacteria displaying calb on the surface and method for catalytically synthesizing short-chain aromatic esters
A Pichia pastoris, surface display technology, applied in the field of whole-cell enzyme preparations to efficiently catalyze the synthesis of short-chain aromatic esters
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0027] Production of a Pichia pastoris whole-cell enzyme preparation surface-displaying Candida antarctica lipase B.
[0028] First, primers were designed according to the nucleotide sequence of Candida antarctica lipase (calb) gene LF058 (the upstream primer is 5'TGTAGAATTCCTGCCTTCCGGTTCGGACCCTG 3', the EcoR I restriction site was introduced, and the downstream primer 5'GAGGCCGTAGCAGTGGGGATGCGCATAGAGCTCAGGTCCTCCACGAG 3' was introduced into Mlu I restriction site). The full-length calb was amplified by PCR using the genomic DNA of Candida antarctica as a template. The PCR program was as follows: pre-denaturation at 95°C for 5 min, 30 cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min, and extension at 72°C for 10 min.
[0029] Secondly, primers were designed according to the nucleotide sequence of α-lectin. The upstream primer was 5'CTCCGGCATCGTCACCCCTACGCGTATCTCGAGTCCAGGAGGTGCTC 3', which introduced the 19bp downstream end of the CALB gene and the MluI restriction s...
Embodiment 2
[0033] Using acetic acid and ethanol as substrates, a whole-cell enzyme preparation catalyzes non-aqueous phase esterification to prepare ethyl acetate.
[0034] Reagents are pre-used Molecular sieves fully remove water. Add absolute ethanol and glacial acetic acid to n-heptane. After adding, the concentration of absolute ethanol is 0.5mol / L, and the concentration of glacial acetic acid is 0.4mol / L. Take 10 mL of the substrate (288.6 μL of glacial acetic acid, 291.2 μL of absolute ethanol, 9420.2 μL of n-heptane, and the acid-alcohol molar ratio is 1:1.25) mixture in a 50 mL Erlenmeyer flask with a stopper, and add 30 g / L of Example 1 Prepare the lyophilized powder of bacteria, the reaction temperature is 40°C, and then shake the reaction at 200rpm, add 0.6g molecular sieve after 0.5h, react for 3h, the conversion rate of acetic acid can reach 92.1%, and the reaction time is only the report of the close yield 1 / 26 of.
Embodiment 3
[0036] Using butyric acid and isoamyl alcohol as substrates, whole-cell enzyme preparation catalyzed non-aqueous phase esterification to prepare isoamyl butyrate.
[0037] Reagents are pre-used Molecular sieves fully remove water. Add isoamyl alcohol and butyric acid to n-heptane. After the addition, the concentration of isoamyl alcohol was 0.88 mol / L, and the concentration of butyric acid was 0.8 mol / L. Take 10mL of substrate (734.3 μL of butyric acid, 957.7 μL of isoamyl alcohol, 8308 μL of n-heptane, and the acid-alcohol molar ratio is 1:1.1) mixture in a 50 mL Erlenmeyer flask with a stopper, and add 20 g / L of Example 1 Prepared thalline freeze-dried powder, reaction temperature 50 DEG C, shake reaction under 200rpm then, add 0.6g molecular sieve after 0.5h, react 3h, the conversion rate of butyric acid can reach 97%, report with Yang Benhong (Yang Benhong. Non-water Compared with lipase-catalyzed synthesis of isoamyl butyrate. China Food Additives, 2005, 5: 74-79) Rhi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More