Method for efficiently expressing and producing T4 lysozyme through recombinant hansenula polymorpha in constitutive mode

A polytype Hansenula, high-efficiency expression technology, applied in the field of high-efficiency expression and production of T4 lysozyme, to achieve the effect of broad antibacterial spectrum, strong antibacterial activity, and extended shelf life

Active Publication Date: 2010-09-15
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] Prior to the present invention, there was no report of constitutively expressing the protein in Hansenula using the codon-optimized T4 lysozyme gene, and no one used the Hansenula plasma membrane ATPase gene as a homologous sequence to express T4 lysozyme There is no report on the integration of the enzyme gene into the Hansenula genome, and no one has carried out high-density fermentation production of T4 lysozyme recombinant protein in Hansenula

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently expressing and producing T4 lysozyme through recombinant hansenula polymorpha in constitutive mode
  • Method for efficiently expressing and producing T4 lysozyme through recombinant hansenula polymorpha in constitutive mode
  • Method for efficiently expressing and producing T4 lysozyme through recombinant hansenula polymorpha in constitutive mode

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: Artificial synthesis of T4 lysozyme gene after codon optimization

[0043]The T4 lysozyme gene is derived from T4 bacteriophage, and its codons are closer to prokaryotes, while Hansenula belongs to eukaryotes, so they have certain differences in gene codon preferences, and this difference is likely to affect Stability and expression efficiency of T4 lysozyme gene and its transcript in Hansenula cells. In order to improve the biological yield of T4 lysozyme, according to the DNA sequence and amino acid sequence (GenBank, accession number: NY000866) of the published T4 lysozyme gene, under the premise of not changing its amino acid sequence (see SEQ ID NO.1), according to The codons preferred by yeast (Sharp P M, et al., 1986), the DNA coding sequence of the new T4 lysozyme mature protein was artificially designed and synthesized, and the T4 lysozyme gene after codon optimization and transformation was compared with that before transformation , 138 nucleoti...

Embodiment 2

[0044] Embodiment 2: Cloning of T4 lysozyme gene

[0045] The above artificially synthesized T4 lysozyme gene DNA fragment was directly inserted into the T site of the pEASY-T1 (purchased from Beijing TransGenic Company) plasmid, and the bacteria containing the intermediate plasmid vector mT4-T were obtained according to the method provided by the company. Cloning, and then, through DNA sequencing, it was determined that the T4 lysozyme gene contained in it was correct and complete (DNA sequencing was completed by Beijing Biaokai Technology Co., Ltd.).

Embodiment 3

[0046] Example 3: Cloning of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase promoter

[0047] According to the known Pichia glyceraldehyde-3-phosphate dehydrogenase promoter sequence (GenBank: U62648.1), synthesize primers F and R located at both ends of the promoter, wherein F is 5'-AT GGATCC TTTTTTGTAGAAATGTCTTGGTGTC-C-3' (underlined part is BamH I cutting point) (see SEQ ID NO.5), R is 5'-AT GAGCTC TGTGTTTTGATAGTTGTTCAATTGAT TG-3' (the underlined part is the cut point of Sac I) (see SEQ ID NO.6), using Pichia pastoris genomic DNA as a template (for the genome extraction method, see page 485 of "Molecular Cloning Experiment Guide, Third Edition"), Using F and R as primers, the glyceraldehyde-3-phosphate dehydrogenase promoter sequence (GAPDH) was amplified by PCR, and the amplified fragment was directly inserted into the T site of the pEASY-T1 plasmid, according to the company's According to the provided method, a bacterial clone containing the intermediate plas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for efficiently expressing and producing recombinant protein of T4 lysozyme in a recombinant hansenula polymorpha cell in a constitutive mode. The method comprises the following steps: 1) increasing the biological output of T4 lysozyme genes in a eukaryotic expression system, namely hansenula polymorpha cells, by using the T4 lysozyme gene with optimized codon; 2) taking a coded sequence of a plasmalemma ATP enzyme nucleotide derived from the hansenula polymorpha as a homologous sequence for completely integrating exogenous plasmid into the hansenula polymorpha genome; 3) adjusting and controlling the high-efficiency expression of the T4 lysozyme gene in the hansenula polymorpha in the constitutive mode by using pichiapastoris glyceraldehyde-3-phosphate dehydrogenase promoter; and 4) providing a specific hansenula polymorpha engineering bacteria fermentation culture and growth condition so as to improve the biological output of recombinant protein of T4 lysozyme and quickly extract the recombinant exogenous protein. The recombinant protein of T4 lysozyme finally prepared by the method has biological activity and can be widely applied in fields such as medicinal treatment, foods, feeds, scientific research and the like.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for constitutively expressing and producing T4 lysozyme through recombinant Hansenula polytype. Background technique [0002] Lysozyme (Lysozyme, EC3.2.17) refers to a class of proteolytic enzymes that widely exist in nature and have killing or inhibiting effects on a variety of Gram-positive and negative pathogenic bacteria, fungi, and certain viruses. First discovered by British bacteriologist Fleming. The main bactericidal method of lysozyme is to destroy the β-1,4 glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine in the bacterial cell wall, causing the cell wall to rupture and the lysate to leak out, resulting in bacterial collapse and Therefore, lysozyme is also called N-acetylmuramidase. In nature, lysozyme has a wide range of sources, which can be divided into lysozyme from animals, plants and microorganisms. Animal-derived lysozyme general...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/56C12N1/19C12N15/63C12N9/36C12R1/78
Inventor王楠刘德虎李刚强
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI