Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Prokaryotic expression vector of dihydroxyacetone kinase and construction method and applications thereof

A prokaryotic expression and carrier technology, which is applied in the field of prokaryotic expression vectors for high-efficiency expression of dihydroxyacetone kinase protein, can solve problems such as complicated operation process, lack of research and purification, and inconvenient reuse

Inactive Publication Date: 2010-09-29
KUNMING UNIV OF SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still no research on purifying Pichia pastoris DAK and preparing its specific antibody
Since the expression level of DAK in natural yeast is not high, the purification process of DAK protein purification by classical methods is very complicated. Usually, the purification of DAK protein by this method requires large-scale cultivation of yeast, and several columns with different properties. And use professional instruments to control the elution conditions, the cost of protein purification is very high, so this kind of method is not convenient for repeated use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prokaryotic expression vector of dihydroxyacetone kinase and construction method and applications thereof
  • Prokaryotic expression vector of dihydroxyacetone kinase and construction method and applications thereof
  • Prokaryotic expression vector of dihydroxyacetone kinase and construction method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: Preparation and detection of Pichia pastoris genomic DNA:

[0035] The Pichia pastoris (Candida boidinii) used in the present invention was purchased from China Industrial Microorganism Culture Collection Center, and the genomic DNA of Pichia pastoris was prepared by the CTAB method. Take 1.5mL of the bacterial liquid and centrifuge at 4000rpm for 2min at 4°C, discard the supernatant, and collect the bacterial cells. Add 400 μl 2×CTAB (Tris-HCl pH 7.5 100 mM, EDTA 20 mM, NaCl 1.4 M, CTAB 2%) to homogenate, incubate at 65° C. for 20 minutes, add 500 μl chloroform to mix, and centrifuge at room temperature at 13,000 rpm for 10 minutes. Transfer the supernatant, add 50 μl of 10% CTAB, add 650 μl of isopropanol and place at room temperature for 1 hour, centrifuge at 12,000 rpm at 4°C for 25 minutes, wash the precipitate once with 500 μl of 75% alcohol, dry it in vacuum, add 20 μl of TE containing RNase to dissolve, Incubate at 37°C for one hour. Get 2 μ l ge...

Embodiment 2

[0036] Example 2: Amplification and TA cloning of DAK gene:

[0037] The amplification of DAK gene and the strategy of TA cloning are as follows: figure 2 As shown, first search the full-length gene sequence of DAK from GenBank (the GenBank accession number of DAK gene is AF019198), and design a pair of primers, the sequence is as follows:

[0038] DAK5: CATGGCTAGTAAACATTGGGATTAC

[0039] DAK3: CTCGAGCAACTTGGTTTCAGATTTGAAG

[0040] A C is added to the end of primer DAK5 at the 5' end to form an NcoI restriction site; an XhoI restriction site is added to the end of primer DAK3 at the 3' end.

[0041] Add 10 μg of Pichia pastoris genomic DNA as a template to the PCR reaction mixture, add 50 μg of specific primers DAK5 and DAK3, 1.8 μl of ldNTP (2.5 mM), 5 μl of Long Taq reaction buffer and 0.3 μl of long Taq (2.5 U / μl) polymerase (purchased from Tiangen Biochemical Technology), and double distilled water was added to make the final reaction volume 20 μl. Heat at 94°C for 3 ...

Embodiment 3

[0042] Embodiment 3: Construction of prokaryotic expression vector pET28a-DAK:

[0043] The construction strategy of pET28a-DAK is as follows Figure 4 As shown, the purified prokaryotic expression plasmid vectors pET28a (purchased from Novagen) and pMD18-DAK were cut with NcoI (Fermentas) and XhoI (Fermentas), and the cut vectors and inserts were separated by agarose gel electrophoresis. The vector fragment pET28a (5.4kb) generated after pET28a was cut and the DNA fragment (1.8kb) of the DAK gene generated by cutting pMD18-DAK were recovered from the gel, and then the pET28a vector was ligated with the ligase kit of TaKaRa Fragmentation and DNA fragmentation of the DAK gene to generate the prokaryotic expression vector pET28a-DAK. Conversion of high efficiency (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology), spread the transformed Escherichia coli on a plate added with kanamycin (Km, 50 μg / ml), cultivate overnight at 37°C, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a prokaryotic expression vector (pET28a-DAK) of Pichia pastoris DAK. The vector contains a T7 promoter, a T7 terminator, a bacteria ribosome binding site, DAK gene and a histidine tag. The DAK gene is cloned from the Pichia pastoris, the T7 promotor is utilized to control the expression of the DAK gene in escherichia coli, and the vector is utilized to convert the escherichia coli (BL21) to realize the high-level expression of DAK proteins. Most of recombinant proteins are soluble proteins and account for 50 percent of soluble total proteins of the escherichia coli; high-purity recombinant DAK proteins can be easily obtained by purifying the soluble total proteins of the escherichia coli by utilizing affinity chromatography and are used for the preparation or biochemical characteristic analysis of DAK antibodies. The invention expression level of the DAK recombinant protein is high; bacteria do not need to be cultured on a large scale; the operation of purifying the DAK protein is quiet simple, has very low cost and is extremely easy to use.

Description

Technical field: [0001] The invention belongs to the field of microbial genetic engineering, and in particular relates to a prokaryotic expression vector pET28a-DAK for efficiently expressing dihydroxyacetone kinase protein (DAK) and its application in the prokaryotic expression of DAK protein and the preparation of DAK protein antibody. Background technique: [0002] Formaldehyde is a colorless gas with a strong pungent odor. It is easily soluble in water, alcohol and ether. It is widely used in industrial production and is the most widely used chemical raw material in the adhesive industry. With the development of the economy and the improvement of people's living standards, building decoration materials made of various raw materials have entered various indoor public places and homes, making formaldehyde the most representative chemical substance recognized as indoor air pollution. The allowable value of free formaldehyde concentration in indoor air is 0.08 (mg / cubic mete...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/54C12N9/12C07K16/40
Inventor 陈丽梅肖素勤孙振张婧
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com