Vibrio cholerae O139 capsular polysaccharide conjugate vaccine and preparation method thereof

A Vibrio cholerae-conjugated vaccine technology, applied in the direction of carrier-bound antigen/hapten components, pharmaceutical formulations, antibacterial drugs, etc., can solve the problems of expensive treatment, inability to control the occurrence and spread of diseases, and small side effects

Active Publication Date: 2011-06-08
BEIJING MINHAI BIOTECH
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although antibiotics and hydration therapy can save many patients, they are unable to control the occurrence and spread of the disease, and the treatment cost is very expensive. Therefore, it is imperative to develop a cholera vaccine that is cheap, has few side effects, and is easy to administer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio cholerae O139 capsular polysaccharide conjugate vaccine and preparation method thereof
  • Vibrio cholerae O139 capsular polysaccharide conjugate vaccine and preparation method thereof
  • Vibrio cholerae O139 capsular polysaccharide conjugate vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Preparation of Vibrio cholerae O139 capsular polysaccharide

[0025] Take Vibrio cholerae O139 (V.cholerae, CMCC 93-3) (purchased from the Chinese Medical Bacteria Preservation and Management Center) freeze-dried working seed batch strain, suspend it in ordinary meat water, shake culture at 37°C for 5h, and take it with an inoculation loop Activated liquid strains, streaked and inoculated on solid plates to separate individual colonies, cultured at 37°C for 16-18h, randomly picked colonies for slide agglutination test; picked well-agglutinated colonies, cultured in a small amount of liquid, and then transferred Into the small fermentation tank to prepare the seed liquid, and then aseptically inject it into the large culture tank, where the fermentation medium adopts trypsin digestion-thick Jingle medium, the inoculum is 5%-10%, and the culture temperature is 30 -35℃, aeration and stirring, the pH value is maintained at about 7.6-8.0. The seed pot is cultivated f...

Embodiment 2

[0027] Example 2 Construction of Vibrio cholerae B subunit engineering bacteria

[0028] 1. Design primers according to the B subunit coding gene of Vibrio cholerae published by NCBI (GenBank accession number: EU854477.1), and the upstream primer CTB-F: GATAT ATGATTAAATTAAAATTTG (SEQ ID No.1), downstream primer CTB-R: CCG TTAATTTGCCATACTAATTGC (SEQ ID No. 2);

[0029] 2. Using the genomic DNA of Vibrio cholerae O1 strain V.cholerae CMCC 569B (purchased from the Chinese Medical Bacteria Collection and Management Center) as a template, a 375bp coding gene fragment of Vibrio cholerae B subunit was obtained by PCR amplification;

[0030] 3. Double-enzyme digestion of the target gene fragment with Bgl II and Xho I, ligate it with the expression vector pET-22b digested with the same endonuclease, and introduce it into the host cell E.coli BL21(DE3), and get it after screening The engineered strain that efficiently secretes and expresses the B subunit of cholera toxin, named: E.coli MHCTB...

Embodiment 3

[0032] Example 3 Preparation of Vibrio cholerae B subunit

[0033] The preparation of cholera B subunit is divided into several stages: seed liquid preparation, large tank culture, centrifugation, concentration and purification, filtration sterilization and cryopreservation.

[0034] First, inoculate the working seed batch strain prepared in Example 2 in fresh LB liquid medium containing 50μg / mL ampicillin at a final concentration, and cultivate it overnight at 32°C to prepare seed liquid for inoculation in the fermentor. Fermentation can select suitable large intestine Bacillus growth medium. In the fermenter, when the bacteria grow to OD 600 =20, add IPTG at a final concentration of 0.2mmol / L to induce, continue to culture for 6-8h, stop the culture, adjust the pH of the fermentation broth to 6.5, 8000rpm, 4℃ continuous centrifugation, collect the supernatant, not more than 10kD ultra The CTB solution was concentrated by the filter membrane and purified by ion exchange chromatog...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vibrio cholerae O139 capsular polysaccharide conjugate vaccine which comprises a conjugate of vibrio cholerae O139 capsular polysaccharide and a protein carrier, wherein the protein carrier is preferential to be a cholera toxin B-subunit. The invention also provides a preparation method of the conjugate vaccine, which comprises the step of coupling the vibrio cholerae O139 capsular polysaccharide and the carrier protein with a mass ratio of (0.2-3):1. After the vibrio cholerae O139 capsular polysaccharide conjugate vaccine is subcutaneously injected to an immune mouse, the conjugate vaccine can excite the mouse to generate antibodies for resisting vibrio cholerae O139 and antibodies for resisting cholera toxin, thus the titer of vibriocidal antibodies can be improved by more than 2 times, and the titer of the antibodies for resisting the cholera toxin (IgG and IgA) can be improved by more than 4 times.

Description

Technical field [0001] The invention relates to a vibrio cholerae O139 capsular polysaccharide conjugate vaccine and a preparation method thereof. Specifically, the present invention relates to the purification of Vibrio cholerae O139 capsular polysaccharide and the subsequent preparation method of the conjugate vaccine Background technique [0002] Cholera is a severe intestinal infection caused by Vibrio cholerae. The disease is spread through fecal contaminated water and food. Humans are the natural host of Vibrio cholerae, and watery diarrhea occurs after infection. In severe cases, it can cause hypovolemic shock, renal failure, hypokalemia, acidosis, and eventually death. At present, cholera is still a serious public health incident. It is necessary to completely eliminate the threat of cholera to human society, and improve personal hygiene, food safety and sanitation facilities is a long-term control mechanism; however, it is difficult for cholera endemic areas to control ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/385A61K47/48A61K9/12A61K9/00A61K9/48A61K9/20A61P31/04A61P1/00A61K39/106A61K47/64
Inventor张静飞魏文进陈磊
OwnerBEIJING MINHAI BIOTECH