Immunity-chromatography kit for rapid diagnosis of malaria and its pathogen species and preparation method thereof

A technology of immune chromatography and pathogens, applied in the field of disease detection, can solve problems such as not suitable for large-scale field application, limited practical value of disease control work, complex equipment and instruments, etc., achieve rapid and intuitive result observation, simple and fast detection method, good stability effect

Active Publication Date: 2011-06-22
SHANGHAI NEW JIEER CLEANING PRODS
View PDF3 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods have certain limitations when used in the field, require higher operating techniques and complex equipment and instruments, and are not suitable for large-scale field applications like traditional methods, so their practical value in disease control work is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunity-chromatography kit for rapid diagnosis of malaria and its pathogen species and preparation method thereof
  • Immunity-chromatography kit for rapid diagnosis of malaria and its pathogen species and preparation method thereof
  • Immunity-chromatography kit for rapid diagnosis of malaria and its pathogen species and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1. Preparation of Plasmodium Antigens

[0065] (1) PCR amplification of pLDH gene primers

[0066] According to BzikDJ, FoxBA, GonyerK. Expression of Plasmodium falciparumlactatedehydrogenasein Escherichiacoli [J]. MolBiochemParasitol, 199359: 155-166. Design a pair of primers for amplifying the full-length coding gene of Plasmodium falciparum LDH.

[0067] P1: 5′ ATGGCACCAAAAGCAAAAATCGT 3′

[0068] P2: 5′TTAAGCTAATGCCTTCATTCCTCT 3′

[0069] (2) template

[0070] Heparin anticoagulated whole blood collected from patients with falciparum malaria in Yunnan was treated as a template for PCR amplification according to the method of John E. Protocols inmolecular parasitology [M]. , 0.015% saponin, 1mmol / L ethylenediaminetetraacetic acid (EDTA)] shake and mix well, place at room temperature at 10mim to fully dissolve red blood cells, centrifuge at 10000×g for 10min at room temperature, and then use 250μL buffer [10mmol / L trimethylol Aminomethane (Tris)-HCl, pH 8.3...

Embodiment 2

[0073] Example 2. Preparation of Plasmodium Lactate Dehydrogenase Monoclonal Antibody

[0074] Immunize each BALB / c mouse with the first intraperitoneal injection of 100 μg of the above-mentioned purified recombinant fusion protein + Freund’s complete adjuvant suspension, and then inject 100 μg of the purified recombinant fusion protein + Freund’s incomplete adjuvant mixture every 1 month. Suspension once, a total of 2 times, and 3 days before the spleen was killed for cell fusion, the antigen was directly injected through the tail vein to boost the immunization once.

[0075] Production and screening of hybridoma cells The fusion of SP2 / 0 tumor cells and splenocytes of immune mice and the cloning of hybridoma cells were carried out according to the routine methods of our laboratory. Use the above-mentioned purified recombinant fusion protein and glutathione 2S2 transferase (GST) protein to coat the plate respectively, and perform conventional ELISA to detect antibody secretio...

Embodiment 3

[0086] Example 3. Preparation of Plasmodium Specific Antibody Gold Probe Solution

[0087] Prepare colloidal gold probe solution and gold-labeled antibody pad labeled with Plasmodium-specific antibody as follows: Colloidal gold is prepared by citric acid reduction method: HAuCl with a mass percentage concentration of 0.01% 4 (Shanghai trial brand was purchased from Shanghai Sinopharm Group Chemical Reagent Co., Ltd.) aqueous solution was boiled, and 2 mL of trisodium citrate aqueous solution with a mass percentage concentration of 1% was added under stirring, and continued boiling until the liquid was dark red to obtain a colloidal gold solution.

[0088] Determination of colloidal gold-conjugated antibody saturation: use 0.1M K 2 CO 3 Adjust the pH value of the solution to 8.5, prepare a 96-well microtiter plate, dilute the Plasmodium-specific antibody with 0.05M boric acid buffer in the well, make a dilution gradient, add the same volume of colloidal gold to mix, and then a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an immunity-chromatography kit for the rapid diagnosis of malaria and its pathogen species and a preparation method thereof. The kit comprises a colloidal gold immunity-chromatography test strip, a matching cell-free lysate, a sample cup, a blood taking needle, and an operating instruction. The colloidal gold immunity-chromatography test strip comprises a sample pad, a colloidal-gold pad, a cellulose membrane, and a water-absorbing pad, wherein the colloidal-gold pad contains colloidal gold labelled antibodies; a detection line and a quality control line are disposed on the cellulose membrane; and the colloidal gold labelled antibody and the detection line are composed of monoclonal antibodies which can specifically bind the lactate dehydrogenase of plasmodia. The immunity-chromatography kit for the rapid diagnosis of malaria and its pathogen of the invention can distinguish falciparum malaria from vivax malaria, has the advantages of simplicity, sensitivity, specificity, and rapidity, and is suitable for clinical and field applications.

Description

technical field [0001] The invention relates to the field of disease detection, in particular to a malaria detection test strip and a manufacturing method thereof Background technique [0002] Malaria is a disease that seriously endangers human health. It is transmitted through the bite of human blood by Anopheles mosquitoes that are active from dusk to dawn. According to the World Health Organization (WHO), malaria is one of the 10 most common and deadly diseases in the world, threatening a total of 2.4 billion people (40% of the global population) in 101 countries and regions. There are between 300 and 500 million clinical cases of malaria every year, and 2 to 2.7 million people die. In my country, according to the 2004 epidemic report, there were reports of malaria cases in 1005 counties in 23 provinces (cities, districts) across the country (excluding Taiwan, Hong Kong and Macao). There were 38,972 cases of malaria, with an average incidence rate of 0.38 / 10,000; 31 peo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/577C07K16/40C12N5/20
CPCY02A50/30
Inventor汪俊云石锋杨玥涛包意芳高春花汤林华
OwnerSHANGHAI NEW JIEER CLEANING PRODS