Immunity-chromatography kit for rapid diagnosis of malaria and its pathogen species and preparation method thereof
A technology of immune chromatography and pathogens, applied in the field of disease detection, can solve problems such as not suitable for large-scale field application, limited practical value of disease control work, complex equipment and instruments, etc., achieve rapid and intuitive result observation, simple and fast detection method, good stability effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Example 1. Preparation of Plasmodium Antigens
[0065] (1) PCR amplification of pLDH gene primers
[0066] According to BzikDJ, FoxBA, GonyerK. Expression of Plasmodium falciparumlactatedehydrogenasein Escherichiacoli [J]. MolBiochemParasitol, 199359: 155-166. Design a pair of primers for amplifying the full-length coding gene of Plasmodium falciparum LDH.
[0067] P1: 5′ ATGGCACCAAAAGCAAAAATCGT 3′
[0068] P2: 5′TTAAGCTAATGCCTTCATTCCTCT 3′
[0069] (2) template
[0070] Heparin anticoagulated whole blood collected from patients with falciparum malaria in Yunnan was treated as a template for PCR amplification according to the method of John E. Protocols inmolecular parasitology [M]. , 0.015% saponin, 1mmol / L ethylenediaminetetraacetic acid (EDTA)] shake and mix well, place at room temperature at 10mim to fully dissolve red blood cells, centrifuge at 10000×g for 10min at room temperature, and then use 250μL buffer [10mmol / L trimethylol Aminomethane (Tris)-HCl, pH 8.3...
Embodiment 2
[0073] Example 2. Preparation of Plasmodium Lactate Dehydrogenase Monoclonal Antibody
[0074] Immunize each BALB / c mouse with the first intraperitoneal injection of 100 μg of the above-mentioned purified recombinant fusion protein + Freund’s complete adjuvant suspension, and then inject 100 μg of the purified recombinant fusion protein + Freund’s incomplete adjuvant mixture every 1 month. Suspension once, a total of 2 times, and 3 days before the spleen was killed for cell fusion, the antigen was directly injected through the tail vein to boost the immunization once.
[0075] Production and screening of hybridoma cells The fusion of SP2 / 0 tumor cells and splenocytes of immune mice and the cloning of hybridoma cells were carried out according to the routine methods of our laboratory. Use the above-mentioned purified recombinant fusion protein and glutathione 2S2 transferase (GST) protein to coat the plate respectively, and perform conventional ELISA to detect antibody secretio...
Embodiment 3
[0086] Example 3. Preparation of Plasmodium Specific Antibody Gold Probe Solution
[0087] Prepare colloidal gold probe solution and gold-labeled antibody pad labeled with Plasmodium-specific antibody as follows: Colloidal gold is prepared by citric acid reduction method: HAuCl with a mass percentage concentration of 0.01% 4 (Shanghai trial brand was purchased from Shanghai Sinopharm Group Chemical Reagent Co., Ltd.) aqueous solution was boiled, and 2 mL of trisodium citrate aqueous solution with a mass percentage concentration of 1% was added under stirring, and continued boiling until the liquid was dark red to obtain a colloidal gold solution.
[0088] Determination of colloidal gold-conjugated antibody saturation: use 0.1M K 2 CO 3 Adjust the pH value of the solution to 8.5, prepare a 96-well microtiter plate, dilute the Plasmodium-specific antibody with 0.05M boric acid buffer in the well, make a dilution gradient, add the same volume of colloidal gold to mix, and then a...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com