Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof

A technology of hydroxypropionic acid and hydroxypropionic acid coenzyme, applied in the field of genetic engineering bacteria, can solve problems such as complex production process, and achieve the effects of simple production process, high conversion efficiency and broad application prospects

Active Publication Date: 2013-03-27
TSINGHUA UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This is the first report on the synthesis of homopolymeric P(3HP) using glycerol as a precursor by microbial methods. The final accumulated P(3HP) accounts for only 12% of the dry weight of cells, and requires a two-step culture method, and the production process is relatively complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof
  • Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof
  • Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1, the construction of expression engineering bacteria

[0059] 1. Construction of expression vector pZQ03

[0060] 1) Extract the genome of Alcaligenes eutropha (Ralstonia eutropha H16) (ATCC number: 17699, which can be purchased from the American Type Culture Collection), use the R.eutropha H16 genome as a template, and use P Re Sense and P Re Antisense is used as a primer, and pfu enzyme is used for PCR reaction to amplify the target promoter P Re , and designed to introduce enzyme cleavage sites at both ends of the fragment.

[0061] P Re Sense: 5'ATAA GTC GAC CTCCTATTTGATTGTCTCTCTGCCGTC 3' (Sequence 6)

[0062] SalI

[0063] P Re Antisense: 5'TTAA GGGCCC GATGCGAGCGCTGCATACCGTC 3' (SEQ ID NO: 7)

[0064] ApaI

[0065] PCR reaction conditions:

[0066] Pre-denaturation at 94°C for 8min; then denaturation at 94°C for 30sec, annealing at 60°C for 30sec, extension at 72°C for 1min24sec, 29 cycles; then extens...

Embodiment 2

[0113] Embodiment 2, the experiment of producing 3-hydroxypropionic acid homopolymer P (3HP) with expression engineered bacteria

[0114] 1. Shake flask culture test

[0115] 1. Use LB as medium to produce 3-hydroxypropionic acid homopolymer P(3HP)

[0116] Express engineering bacteria E.coliTrans1-T1 (pZQ01, pZQ03), E.coliTrans5α (pZQ01, pZQ03) and E.coliS17-1 (pZQ01, pZQ03) were respectively cultured in LB medium at 37°C and 200rpm overnight; % inoculum size (v / v), inoculated into 100mL LB medium containing 1,3-propanediol (1,3-PDO) respectively (containing: 5g / L yeast extract, 10g / L peptone, 10g / L NaCl, 10g / L 1,3-PDO, the rest is water, pH 7.0-7.2), 37°C, 200rpm, shake the flask for 48 hours to obtain the bacterial liquid. Three sets of parallels were set up for each strain. Use nuclear magnetic resonance spectrometer NMR (JEOL, ECA-600SCC) and gas chromatography (GC, Hewlett-Packard model 6890) to verify the accumulation of homopolymers in cells; use gas chromatography ...

Embodiment 3

[0171] Embodiment 3, shake flask experiment of producing P (3HP-co-4HB) copolymer with expressing engineered bacteria E.coli S17-1 (pZQ01, pZQ03)

[0172] Express engineered bacteria E.coliS17-1 (pZQ01, pZQ03) with LB, LB' and TB medium, culture overnight at 37°C, 200rpm; then inoculate to 100mL at 5% inoculum size (v / v) LB, LB' and TB cultures containing different concentrations of 1,3-propanediol (1,3-PDO, see Table 4) and / or different concentrations of 1,4-butanediol (1,4-BD, see Table 4) Base, 37°C, 200rpm, cultured in shake flasks for 48 hours, and set up three parallel groups for each strain.

[0173] Using the conditions in the above-mentioned gas phase detection method, the standard sample is prepared as follows:

[0174] Preparation of standard samples of 3-hydroxypropionic acid and 4-hydroxybutyric acid copolymer: get about 30ul of 30% concentration (volume concentration) of 3HP (Tokyo Chemical Industry Co., Ltd. (TCI), catalog number H0297) aqueous solution in este...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
tensile strengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant strain for producing a 3-hydracrylic acid homopolymer and / or a 3-hydracrylic acid copolymer and an application thereof. The construction method of the recombinant strain comprises the following steps: leading 1,3-Propanediol dehydrogenase coded genes, aldehyde dehydrogenase coded genes, 3-hydracrylic acid coenzyme A ligase coded genes and PHA (Polyhydroxyalkanoates) polymerase coded genes into a starting strain to obtain the recombinant strain. The experiments in the invention prove that the engineering bacteria can efficiently express 3-hydracrylic acid coenzyme A ligase coded genes and PHA polymerase coded genes and enable the 3-hydracrylic acid to be finally polymerized into 3-hydracrylic acid homopolymer (P(3HP)) from the 3-hydracrylic acid coenzyme A. Minitype fermentation tank experiments show that the engineering bacteria provided by the invention can have a maximum P (3HP) output of 8.9g / L after being fermented in a 6L fermentation tank and the P (3HP) can account for a maximum 91.5% of cell dry weight. In addition, the recombinant strain provided by the invention has the advantages of simple production process, low costs and broad application prospects.

Description

technical field [0001] The invention relates to a genetic engineering bacterium, in particular to a recombinant bacterium producing 3-hydroxypropionic acid homopolymer and / or 3-hydroxypropionic acid copolymer and application thereof. Background technique [0002] Polyhydroxyalkanoates (PHAs) are a class of polymers that are accumulated intracellularly by many microorganisms under unbalanced growth conditions, and have excellent properties such as thermoplasticity, biocompatibility, optical activity, and piezoelectric properties. In nature, it can be completely degraded by microorganisms to produce water and carbon dioxide. It is entirely possible to replace chemical plastics that are increasingly polluting the environment, and it is also of great application value in medicine, pharmacy, and fine chemistry. Its structural formula is as shown in formula I: [0003] [0004] According to the type of monomer, PHA is divided into homopolymer (homopolymer) and copolymer (copo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N15/52C12N15/54C12N15/63C12N1/21C12P7/62C12R1/19
Inventor 陈国强周琴石振宇孟德川吴琼陈金春
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com