Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof
A technology of hydroxypropionic acid and hydroxypropionic acid coenzyme, applied in the field of genetic engineering bacteria, can solve problems such as complex production process, and achieve the effects of simple production process, high conversion efficiency and broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Embodiment 1, the construction of expression engineering bacteria
[0059] 1. Construction of expression vector pZQ03
[0060] 1) Extract the genome of Alcaligenes eutropha (Ralstonia eutropha H16) (ATCC number: 17699, which can be purchased from the American Type Culture Collection), use the R.eutropha H16 genome as a template, and use P Re Sense and P Re Antisense is used as a primer, and pfu enzyme is used for PCR reaction to amplify the target promoter P Re , and designed to introduce enzyme cleavage sites at both ends of the fragment.
[0061] P Re Sense: 5'ATAA GTC GAC CTCCTATTTGATTGTCTCTCTGCCGTC 3' (Sequence 6)
[0062] SalI
[0063] P Re Antisense: 5'TTAA GGGCCC GATGCGAGCGCTGCATACCGTC 3' (SEQ ID NO: 7)
[0064] ApaI
[0065] PCR reaction conditions:
[0066] Pre-denaturation at 94°C for 8min; then denaturation at 94°C for 30sec, annealing at 60°C for 30sec, extension at 72°C for 1min24sec, 29 cycles; then extens...
Embodiment 2
[0113] Embodiment 2, the experiment of producing 3-hydroxypropionic acid homopolymer P (3HP) with expression engineered bacteria
[0114] 1. Shake flask culture test
[0115] 1. Use LB as medium to produce 3-hydroxypropionic acid homopolymer P(3HP)
[0116] Express engineering bacteria E.coliTrans1-T1 (pZQ01, pZQ03), E.coliTrans5α (pZQ01, pZQ03) and E.coliS17-1 (pZQ01, pZQ03) were respectively cultured in LB medium at 37°C and 200rpm overnight; % inoculum size (v / v), inoculated into 100mL LB medium containing 1,3-propanediol (1,3-PDO) respectively (containing: 5g / L yeast extract, 10g / L peptone, 10g / L NaCl, 10g / L 1,3-PDO, the rest is water, pH 7.0-7.2), 37°C, 200rpm, shake the flask for 48 hours to obtain the bacterial liquid. Three sets of parallels were set up for each strain. Use nuclear magnetic resonance spectrometer NMR (JEOL, ECA-600SCC) and gas chromatography (GC, Hewlett-Packard model 6890) to verify the accumulation of homopolymers in cells; use gas chromatography ...
Embodiment 3
[0171] Embodiment 3, shake flask experiment of producing P (3HP-co-4HB) copolymer with expressing engineered bacteria E.coli S17-1 (pZQ01, pZQ03)
[0172] Express engineered bacteria E.coliS17-1 (pZQ01, pZQ03) with LB, LB' and TB medium, culture overnight at 37°C, 200rpm; then inoculate to 100mL at 5% inoculum size (v / v) LB, LB' and TB cultures containing different concentrations of 1,3-propanediol (1,3-PDO, see Table 4) and / or different concentrations of 1,4-butanediol (1,4-BD, see Table 4) Base, 37°C, 200rpm, cultured in shake flasks for 48 hours, and set up three parallel groups for each strain.
[0173] Using the conditions in the above-mentioned gas phase detection method, the standard sample is prepared as follows:
[0174] Preparation of standard samples of 3-hydroxypropionic acid and 4-hydroxybutyric acid copolymer: get about 30ul of 30% concentration (volume concentration) of 3HP (Tokyo Chemical Industry Co., Ltd. (TCI), catalog number H0297) aqueous solution in este...
PUM
Property | Measurement | Unit |
---|---|---|
tensile strength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com