Dengue virus subunit vaccine and preparation method thereof

A subunit vaccine, dengue virus technology, applied in the field of dengue virus subunit vaccine and its preparation, can solve the problems of large differences in mouse protection ability, large difference in protection ability of DV type, and unfavorable promotion, etc. The effect of low mammalian cell expression system, convenient purification route and cost control

Inactive Publication Date: 2011-09-28
ARMY MEDICAL UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Indian Etemad B et al. (2008) and Chinese scholar Chen S et al. (2007) fused the specific regions of the E protein of 4 serotypes of dengue virus together to construct a 4-valent recombinant protein vaccine, which has a certain protective effect at the animal level. And the titer is 1:47-1:588, the protective power of various types of DV is quite different, which is not conducive to popularization
[0011] Singapore Sim CAN et al. (2008) reported a recombinant Streptococcus lactis preparation expressing dengue virus EDIII, but the protective ability of the same or different species of mice varies greatly, and the neutralization effect and immune pathway need to be further evaluated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dengue virus subunit vaccine and preparation method thereof
  • Dengue virus subunit vaccine and preparation method thereof
  • Dengue virus subunit vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0076] After obtaining the recombinant expression plasmid ligation product, a conventional method is to introduce it into the target bacterium, and a preferred method is to use antibiotics (such as ampicillin) corresponding to the resistance gene carried by the plasmid to screen the bacteria transformed by the plasmid, Obtain bacterial clones with stable resistance, amplify the desired clones, induce them with the inducer IPTG, analyze the expression bands by SDS-PAGE electrophoresis, and determine the bacterial clones expressing the target protein.

Embodiment 3

[0078] The clones screened in 2 were cultured, added with 0.5 mM inducer IPTG, induced at 30° C. for 4 hours, collected by centrifugation, and ultrasonically disrupted to prepare recombinant protein inclusion bodies.

[0079] 4. the purification of dengue virus subunit vaccine protein (see embodiment 4)

[0080] The inclusion body was dissolved in 8M urea, and the supernatant was collected by centrifugation, purified by Ni-NTA affinity chromatography column and cation exchange strain respectively, and the elution peak was collected, dialyzed into the preservation solution for later use.

[0081] Conventional reagents used in the present invention are commercially available analytical reagents.

Embodiment 1

[0083] Construction process of dengue virus subunit vaccine recombinant expression plasmid

[0084] 1. PCR amplification of the leader peptide (pelB fragment) sequence

[0085] (1) The guide peptide is the Erwinia carotovora pectinase signal peptide. Design a pair of oligonucleotide fragments according to the signal peptide sequence shown in SEQ NO 1 (Lei SP, et al, J Bacteriol.1987; 169 (9): 4379-4383): P1: GCAAATACCTGCTGCCGACCGCT (NcoI site in bold) (SEQ ID No: 3), P2: GGCCATCGCGGTGGGC (NdeI site in bold) (SEQ ID No: 4) was synthesized by the DNA Synthesis Department of Shenzhen Huada Gene Company.

[0086] (2) Preparation of Genomic DNA of Erwinia carotovora Genome extraction kit is a Promega product, and the operation is carried out according to the company's instructions.

[0087] (3) PCR amplification Use the DNA extracted in (2) as a template, and carry out PCR amplification with P1-P2 primers, and the reaction is as follows:

[0088]

[0089]After mixing, plac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant expression plasmid of a dengue virus subunit vaccine. The recombinant expression plasmid contains a fused coding gene consisting the following elements: A) a signal peptide coding sequence; B) a dengue virus envelope glycoprotein EDIII coding region; and C) six continuous histidine coding sequences shown in SEQ ID NO:9. The vaccine is safe and new, has good immune effect and is suitable for industrialized production. The vaccine is fused with the protective antigen component of the dengue virus and can stimulate the organism to generate the immune response and be utilized to prevent the infectious diseases caused by the dengue virus.

Description

technical field [0001] The invention belongs to the high-tech field of biomedicine, in particular to a dengue virus subunit vaccine and a preparation method thereof. Background technique [0002] Dengue virus (DV) is an enveloped single-stranded positive-sense RNA virus of the genus Flaviviridae. It has four serotypes (DV1-4). It uses mosquitoes as a vector and is widely prevalent in tropical and subtropical regions. . Human dengue fever (classical dengue fever, DF) and dengue hemorrhagic fever / dengue shock syndrome (dengue hemorrhagic fever / dengue shock syndrome, DHF / DSS) caused by DV infection seriously endanger human health. There are 2.5 to 3 billion people living in endemic areas in the world, and more than 100 million people are infected every year, with about 500,000 DHF cases and a mortality rate of 5 to 20%. If the treatment is not timely, it can reach 50%. In recent years, with many reasons such as global warming, population flow, ecological environment deteriora...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C07K19/00C07K1/36C07K1/34C07K1/22C07K1/18A61K39/12A61P31/14C12R1/19
CPCY02A50/30
Inventor饶贤才杨杰张俊磊胡珍方昕尚伟龙
OwnerARMY MEDICAL UNIV