Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction

A technology of methyl mandelate and biocatalysis, which is applied in the field of bioengineering, can solve the problems of increasing energy consumption, increasing costs, and failing to solve the problems of coenzyme regeneration, etc., and achieves the effects of simple operation, high catalytic efficiency, and good industrial application prospects

Inactive Publication Date: 2013-06-26
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ema et al. (Adv.Synth.Catal., 2008, 350:2039-2044) from Japan co-expressed carbonyl reductase Gre2 and glucose dehydrogenase, and used recombinant Escherichia coli as a catalyst to asymmetrically reduce 1M o-chlorobenzoylformic acid Synthesis of (R)-o-chloromandelic acid methyl ester with methyl ester, the conversion rate and enantioselectivity of the reaction can reach more than 99%, but this method does not solve the problem of coenzyme regeneration, and still needs to add an additional 1g / L expensive Coenzyme NADP + , which significantly increases the cost of production, and the reaction needs to be carried out at 20°C, which also increases energy consumption to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction
  • Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction
  • Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Cloning of aldehyde and ketone reductase gene

[0040] According to the gene sequence (Gene ID 937984) of the reductase ytbE of Bacillus subtilis (Bacillus subtilis 168) recorded in Genbank, the PCR primers were designed as follows:

[0041] Upstream primer: CGCGGATCCATGACAACACATTTACAAGCAAAAG;

[0042] Downstream primer: CCGGTCGAGTTAAAAAATCAAAGTTGTCCGGATC.

[0043] Wherein, the underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the XhoI restriction site. PCR amplification was performed using the genomic DNA of Bacillus subtilis 168 (purchased from the Bacillus Genetic Stock Center, Ohio State University, USA, BGSC) as a template. The PCR system is: 15 μl of 2×Taq PCR MasterMix, 1 μl (0.3 μmol / L) of each upstream primer and downstream primer, 1 μl (0.1 μg) of DNA template and ddH 2 O 12 μl. PCR amplification steps are: (1) 95°C, pre-denaturation for 5min; (2) 94°C, denaturation for 45s; ...

Embodiment 2

[0044] Example 2 Preparation of recombinant plasmid pET28a-AKR

[0045] The aldehyde and ketone reductase gene target band recovered in Example 1 was double-digested with restriction endonucleases BamHI and XhoI at 37°C for 12 hours, purified by agarose gel electrophoresis, and recovered using an agarose gel DNA recovery kit target fragment. Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET28a digested with BamHI and XhoI at 4°C overnight to obtain the recombinant plasmid pET28a-AKR.

Embodiment 3

[0046] Example 3 Cloning of Glucose Dehydrogenase Gene

[0047] According to the glucose dehydrogenase gene sequence (Gene ID 938261) of Bacillus subtilis (Bacillus subtilis) 168 included in Genbank, design specific primers:

[0048] Upstream primer: TGGTGGTGGTGGTGCTTAACCGCGGCCTGCCTGGAA;

[0049] Downstream primer: ACTTTGATTTTTAACAAGGAGATATACATATGTATCC.

[0050] Using the genomic DNA of Bacillus subtilis 168 as a template, PCR amplification was performed. The PCR system is: 15 μl of 2×Taq PCR MasterMix, 1 μl (0.3 μmol / L) of each upstream primer and downstream primer, 1 μl (0.1 μg) of DNA template and ddH 2 O 12 μl. PCR amplification steps are: (1) 95°C, pre-denaturation for 5min; (2) 94°C, denaturation for 45s; (3) 57°C annealing for 1min; (4) 72°C extension for 1min; steps (2) to (4) repeated 35 times; (5) Continue to extend at 72°C for 10 minutes, then cool to 4°C. The PCR product was purified by agarose gel electrophoresis, and the target band in the interval of 700-900 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
enantiomeric excessaaaaaaaaaa
enantiomeric excessaaaaaaaaaa
Login to View More

Abstract

Disclosed is a method for preparing methyl(R)-o-chloromandelate, wherein a genetic engineering bacterium co-expressing a recombinant aldo-keto reductase and recombinant glucose dehydrogenase is used as a catalyst, and a methyl o-chlorobenzoylformate as a substrate to perform a biotransformation reaction in the presence of glucose. Also disclosed is a recombinant vector containing the base sequences coding the aldo-keto reductase and the glucose dehydrogenase, and the genetic engineering bacterium containing the vector and the use thereof.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for preparing (R)-o-chloromandelic acid methyl ester through biocatalytic asymmetric reduction, a used recombinant carrier and genetically engineered bacteria. Background technique [0002] Clopidogrel (Clopidogrel), chemical name (S)-α-(2-chlorophenyl)-6,7-dihydrothieno[3,2-c]pyridine-5(4H)-acetic acid methyl ester, is A platelet aggregation inhibitor, successfully researched and developed by Sanofi-Aventis (Sanofi-Aventis) company in France in 1986, its sulfate salt is used clinically, the trade name (Plavix), mainly used in the treatment of cardiovascular and cerebrovascular diseases such as atherosclerosis. In 2009, the drug's global sales reached 10 billion US dollars, second only to the blood lipid-lowering drug atorvastatin, and became the second best-selling drug in the global drug market. (R)-o-chloromandelic acid and its methyl ester are i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P7/62C12N15/63C12N15/53C12N1/21C12R1/19
CPCC12P7/62C12N9/0006C12P41/002
Inventor许建和倪燕潘江李春秀马宏敏
OwnerEAST CHINA UNIV OF SCI & TECH