Method for producing 2-keto-L-gulonic acid vitamin C precursor by modifying Escherichia coli

A technology of Escherichia coli, 2-KLG

Active Publication Date: 2011-11-23
JIANGNAN UNIV
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the two-step fermentation process currently used in domestic vitamin C industrial production has the advantages of short production cycle and low cost, there are also some problems at the same time, such as: (1) high energy and material consumption and high cost; (2) waste gas, The discharge of waste water and waste residue is large; (3) The process is complicated and the product innovation is less, which restricts the further development of the vitamin C industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The construction of embodiment 1 expression vector

[0019] Design primers P1: 5'GGAATTCCATATGATGAAACCGACTTCGCTGCTTTGGGC3'; P2: 5'CCCAAGCTTTTATTGCGGCAGGGCGAAGACGTAGA3', clone the sdh / sndh gene sequence annotated in the whole genome sequencing results of K. vulgare DSM4205 and clone it into the plasmid pET28a(+) after amplification to construct the expression vector pET28a -sdh / sndh, after transforming the constructed expression vector into E.coli JM109, select the transformant, extract the plasmid and digest it with HindIII and NdeI, a 1740bp band appears, which proves that the expression vector pET28a-sdh / sndh; design primer P3: 5'CCCAAGCTTATGCCGAATACTTATGGCAGCAGAACCC3'P4: 5'ATAAGAATGCGGCCGCTCCAGCCCTTGTGATCAGGCAGTGC3', clone Gluconobacter oxydans ATCC 621H sldh gene sequence amplification and clone it into pET28a(+)-sdh / sndh, transform E.coli JM109, and select transformants After the plasmid was extracted and digested with HindIII and NotI, a 2612bp band appeared, whi...

Embodiment 2E

[0020] The construction of embodiment 2E.coli engineering bacteria

[0021] The finally constructed expression vector pET28a(+)-sdh / sndh-sldh-pqq was transformed into E.coli JM109. Due to the kanamycin resistance gene on the recombinant plasmid, transform E.coli JM109 competent, apply to LB containing kanamycin (yeast extract 5g / L, peptone 10g / L, NaCl 10g / L, solid Add 20g / L agar to the medium, adjust the pH to 7.0, and sterilize at 121°C for 15 minutes), pick the transformants that grew normally on the plate after transformation, and extract the plasmids for PCR verification. Bands of 1740bp, 2612bp, and 3187bp appeared respectively, and the control failed. The same band in PCR proved the successful transformation into E.coli, and then transformed the extracted plasmid into E.coli BL21 to obtain E.coli-pET28a-sdh / sndh-sldh-pqq engineering bacteria.

Embodiment 3

[0022] Embodiment 3 fermentation produces 2-KLG

[0023] Seed and slant medium (g / L): yeast extract 5, peptone 10, NaCl 10; agar 20 (slant medium), pH 7.0, sterilized at 121°C for 15 minutes, final concentration of kanamycin 50 μg / mL.

[0024] Fermentation medium (g / L): sorbose 80, peptone 12, yeast extract 24, glycerin 4ml, potassium dihydrogen phosphate 2.31, dipotassium hydrogen phosphate 12.54, pH 7.0, sterilized at 121°C for 15 minutes, final kanamycin The concentration is 50 μg / mL, and the final concentration of IPTG is 0.5 mM.

[0025] Culture conditions: inoculate the recombinant bacteria from the slant into 20mL seed medium, inoculate the bacteria for 12 hours, inoculate the amount of 10%, fill the liquid with 10%; Shake flask fermentation was carried out at 30° C. and 220 rpm, and the fermentation period was 48 hours. Shake flask 2-KLG yield was 56g / L.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing a 2-keto-L-gulonic acid (2-KLG) vitamin C precursor by modifying Escherichia coli and belongs to the field of genetic engineering. In the method, a sorbitol dehydrogenase (SLDH) gene from gluconobacter oxydans, a pyrroloquinoline quinine (PQQ) gene cluster and a sorbose dehydrogenase (SDH) / sorbosone dehydrogenase gene (SNDH) from common ketogulonigenium vulgare are expressed in Escherichia coli by a genetic engineering technique to culture an Escherichia coli engineering strain for producing 2-KLG by sorbitol. At present, a two-step fermentationprocess adopted for industrial production of vitamin C in China has the problems of complicated process, many influencing factors, difficult accurate control and large raw material and energy consumption for growing three kinds of microbes at the same time. When the production of the 2-KLG by sorbitol fermentation by the E.coli engineering bacteria is adopted, the production process is simplified, raw materials and energy are saved, and the yield of the 2-KLG can reach 87g / L; and thus, the method has a very bright application prospect.

Description

technical field [0001] The invention relates to a high-yield 2-KLG Escherichia coli engineering bacterium and a construction method thereof, which uses molecular means to introduce SLDH, SDH / SNDH and coenzyme PQQ, thereby realizing the production of 2-KLG by metabolizing sorbose, belonging to the field of genetic engineering. Background technique [0002] Vitamin C is an important organic acid widely used in industries such as pharmaceuticals, food, beverages, cosmetics and feed, and 2-KLG is an important precursor for the synthesis of vitamin C. At present, the industrialized production of vitamin C in China adopts a two-step fermentation method, and the two-step fermentation method with D-sorbitol as the substrate is the earliest and most studied production method. In this process, Gluconobacter oxydans converts D-sorbitol into L-sorbose, and L-sorbose into 2-keto-L-gulonic acid (2-keto-L-gulonic acid, 2-KLG) process is completed by a mixed bacteria system, which is compo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/63C12P7/60C12R1/19
Inventor陈坚高丽丽周景文堵国成
OwnerJIANGNAN UNIV