Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Small shuttle plasmid pSDU1 with chloramphenicol resistant gene for Acidithiobacillus caldus

A thermophilic Thiobacillus and resistance gene technology, applied in the fields of molecular biology and bioengineering, can solve the problems of cumbersome operation, low plasmid carrying capacity, restricted plasmid use, etc., and achieve high transformation efficiency, large carrying capacity, and high stability. sexual effect

Inactive Publication Date: 2011-11-23
SHANDONG UNIV
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, the shuttle plasmid pJRD215, which is widely used in Thiobacillus thermophiles, has fewer multiple cloning sites and most of them are uncommonly used enzyme cutting sites. The operation is cumbersome, which limits the use of this plasmid. In addition, the plasmid pJRD215 is relatively large (10, 316bp) , making the carrying capacity of the plasmid smaller

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small shuttle plasmid pSDU1 with chloramphenicol resistant gene for Acidithiobacillus caldus
  • Small shuttle plasmid pSDU1 with chloramphenicol resistant gene for Acidithiobacillus caldus
  • Small shuttle plasmid pSDU1 with chloramphenicol resistant gene for Acidithiobacillus caldus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Extraction of plasmid pACYC184 (purchased from Biovector Co., LTD):

[0037] Use the TaKaRa MiniBEST Plasmid Purification Kit Ver.2.0 plasmid mini-extraction kit (purchased from TaKaRa Company, item number: DV801A), and the specific operation is as follows:

[0038] (1) Add corresponding antibiotics to 20ml LB medium, inoculate with 1% activated bacteria, culture at 37°C, 200rpm, with shaking for 12-14h.

[0039] (2) Pour 5ml of cultured bacterial solution into a centrifuge tube, centrifuge at 12,000rpm for 3min, and aspirate the supernatant.

[0040] (3) Add 250 μl of Solution I (containing RNaseA1), Vortex to the collected cells, fully suspend the cell pellet and transfer the cell solution to a 1.5 ml EP tube.

[0041] (4) Add 250 μl of Solution II, and gently turn it up and down 5-6 times to fully lyse the bacteria and form a transparent solution.

[0042] Note: The bacterium must be fully lysed to form a transparent solution, and the operation must be rapid, an...

Embodiment 2

[0080] 1. Extraction of plasmid pJRD215 (purchased from Biovector Co., LTD): refer to 1 in Example 1.

[0081] 2. Amplify oriV, mob, rep and other genes from plasmid pJRD215:

[0082] Plasmid Use primers Pr4 and Pr5 to amplify oriV, mob, rep and other genes from plasmid pJRD215. Primer Pr4 contains an Alw 44 I restriction site, and Pr5 contains an EcoT 22I restriction site

[0083] (1) The sequences of the above primers are as follows:

[0084] Pr4: CTTCGTGCACTCCTTGCAATACTGTGTT

[0085] Pr5: CTTCATGCATCCCAAGCTTAGAGCATACATCTGGAAGCA

[0086] (2) Preparation of reaction system:

[0087] wxya 2 O: 21 μl; Premix PrimerSTAR HS: 25 μl; Primer Pr4: 1.5 μl (0.3 μM final conc.); Primer Pr5: 1.5 μl (0.3 μM final conc.); Template DNA (plasmid pJRD215): 1 μl.

[0088] (3) Polymerase chain reaction (PCR) cycle:

[0089] The specific steps are: 94°C for 2min; then 98°C for 10s, 55°C for 15s, 72°C for 6min, a total of 29 cycles; finally 72°C for 10min.

[0090] (4) As detected by DNA g...

Embodiment 3

[0092] 1. Construct the intermediate plasmid pSDU:

[0093] The chloramphenicol resistance gene containing the P2 promoter obtained in Example 1 and the ori V, mob, rep and other genes of the plasmid pJRD215 obtained by PCR amplification in Example 2 were doubled using Alw 44 I and EcoT 22 I respectively. Digestion, purification and ligation with T4 DNA ligase (10×T4DNALigase Buffer 1μl, T4DNALigase 1μl, plasmid fragment 1.5μl, gene bphC fragment 6.5μl, 16°C, overnight ligation).

[0094] Add the ligation reaction solution to 50 μl E.coli DH5α competent cells, mix lightly, put in ice bath for 30 min, 42°C for 90 s, immediately put in ice bath for 5 min, add 0.5ml LB liquid medium, incubate at 37°C for 1 h, and spread the above transformation solution Spread on LB medium solid plates containing chloramphenicol, and culture overnight at 37°C.

[0095] Pick the transformant colony on the chloramphenicol screening plate, inoculate it into LB liquid medium containing chloramphenic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a small shuttle plasmid pSDU1 with a chloramphenicol resistant gene for Acidithiobacillus caldus, which consists of a replicor oriV, an auto-replicating protein gene rep, a conjugational transfer gene mob, a chloramphenicol resistance selection gene cat and a multiple cloning site (MCS). The plasmid pSDU1 uses chloramphenicol resistance as a selection marker and has higher conversion efficiency; the multiple cloning sites of the plasmid pSDU1 are introduced, and the use is convenient; the oriV, rep and mob parts of the plasmid pJRD 215 is used, so higher stability is achieved; and the length of the plasmid is only 6.4kbp and the bearing capacity of the plasmid is higher, which indicate the plasmid has a huge application potential in molecular biological research and genetic engineering modification of the Acidithiobacillus caldus.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and bioengineering, and specifically relates to a miniaturized plasmid pSDU1 with a chloramphenicol resistance gene and multiple cloning restriction sites, which can stably exist in Thiobacillus thermophile. Background technique [0002] Acidithiobacillus caldus (A. caldus for short) is a kind of Gram-negative chemical energy inorganic nutrition bacteria, which obtains the energy and reducing power necessary for growth from the oxidation of reducing or partially reducing sulfide. Fixing CO in the air with the Calvin cycle 2 as a carbon source. The bacterium is an obligate autotrophic bacteria with extreme acidophilicity, and its optimal pH is 2-3. It has important uses in bacterial metallurgy, coal desulfurization and treatment of sulfur-containing wastewater. [0003] Because of its unique lifestyle and special status in nature, A.caldus has been widely valued by people for a long ti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N15/66
Inventor 林建强陈林旭林建群
Owner SHANDONG UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More