Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for enzymatic protein cyclization

An enzyme protein, cyclase protein technology, applied in biochemical equipment and methods, microorganism-based methods, botanical equipment and methods, etc., can solve problems such as unfavorable in vitro cyclization, and achieve the effect of good thermal stability

Inactive Publication Date: 2011-12-28
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2000, Thomas C. Evans and Ming-Qun Xu used Ssp DnaE intein to cyclize maltose-binding protein with 395 amino acids in vivo. The disadvantage of this intein cyclization method is that it is not conducive to in vitro cyclization , so to achieve in vitro protein cyclization is a problem that needs to be solved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for enzymatic protein cyclization
  • A method for enzymatic protein cyclization
  • A method for enzymatic protein cyclization

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Cloning of embodiment 1 xylanase gene and construction of circularization vector

[0031] Firstly, the plasmid pTWIN1 (ENB Company) was extracted, and the sequence of the Synechocystis Ssp DnaB intein was amplified by PCR using the extracted plasmid as a template. The primers used were synthesized according to the 5' and 3' end sequences of the DnaB gene. The sequences of the two primers were: 5'ATACATATGA AAATCGAAGA AGGTAAAC 3' and 5'GAATTCGTTG TGTACAATGA TGTCATTC 3'. After amplification, gel electrophoresis was performed to recover the size 680bp fragments. Afterwards, the fragments were recovered after Nde I and EcoRI double digestion. In addition, the sequence of the Mxe GyrA intein of Mycobacterium xenopus was amplified by PCR using the proposed plasmid as a template. The primers used were synthesized according to the 5' and 3' end sequences of the Mxe GyrA gene. The sequences of the two primers were: 5'CTCGAGTGCATCACGGGAGATGCACTAG 3' and 5'GGATCCCCTTCCTGCAGTCATT...

Embodiment 2

[0033] The in vitro cyclization of embodiment 2 xylanase

[0034] 1) Protein cyclization and purification procedures

[0035]Inoculate the recombinants into 20 mL of LB medium, culture with shaking at 37°C overnight, inoculate in 1 liter of LB medium at 1% inoculum size, culture at 37°C until OD is 0.5, add IPTG to a final concentration of 0.5mM, continue After culturing for 3 hours, the expression of xylanase was induced. The bacteria were collected by centrifugation, and the bacteria were resuspended in 100 mL of Tris-HCl (pH 7.0) buffer containing 500 mM NaCl, disrupted by ultrasonic waves, and centrifuged at 13000 rpm for 30 minutes to remove cell debris. The supernatant was passed through a chitin column, and then the column was thoroughly washed with 20 column bed volumes of buffer 1 (20 mM Tris-HCl pH 7.0, 0.5 M NaCl). Stop the column flow and place at 20°C for 16 hours to induce cleavage of the Ssp DnaB intein. Afterwards, pass through the column with buffer solutio...

Embodiment 3

[0038] Embodiment 3 cycloxylanase activity assay

[0039] 1) Standard curve creation

[0040] Draw 1% xylose standard solution 1.0, 2.0, 3.0, 4.0, 5.0ml into a 50ml volumetric flask, distill the volume to the mark with distilled water, dilute to 0.2, 0.4, 0.6, 0.8, 1.0mg / ml xylose standard liquid. Take 0.5ml of diluted xylose standard solution of different concentrations in three test tubes, add 1.5ml of sodium dihydrogen phosphate-citric acid buffer, add 3.0ml of DNS reagent, bathe in boiling water for 5 minutes, then dilute 10ml with deionized water, Mix well. Deionized water was used as a control. Absorbance was measured at 540 nm after cooling. Draw the standard curve with the absorbance value as the ordinate and the xylose concentration as the abscissa. The regression equation of the xylose standard curve is y=0.148x-0.0754, where R 2 = 0.9997.

[0041] 2) Determination of xylanase activity

[0042] Enzyme activity unit (U) is defined as: the amount of enzyme that...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
absorbanceaaaaaaaaaa
Login to View More

Abstract

The invention relates to a method for cyclizing an enzyme protein. The cyclase protein is mediated by Synechocystis Ssp DnaB intein and Mycobacterium xenopus Mxe GyrA intein, and the N and C of the enzyme protein are cyclized by natural peptide bonds. Link both ends. The present invention obtains the cyclized xylanase with enhanced thermostability by the above method.

Description

technical field [0001] The invention relates to a new enzyme protein cyclization method to improve the performance of protease, in particular to a double intein-mediated enzyme protein cyclization method. The present invention also relates to a cyclizing xylanase with enhanced thermostability. Background technique [0002] Many natural enzymes have many performance deficiencies in application, such as low thermal stability. The high-temperature granulation process in the brewing and feed industries requires a temperature of 75°C-90°C and lasts for several minutes. During this process, the activity of the enzyme will be greatly lost, which limits the application of natural enzymes in industrial production. Therefore, improving the thermostability of enzymes has become an urgent problem to be solved. [0003] In vitro protein cyclization is a new technology. After cyclization, it can increase the thermal stability of the protein, reduce the resistance of the protein to hydro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N9/00C12N9/42C12N15/56C12N1/21C12R1/19
Inventor 平淑珍赵仲麟林敏燕永亮陈明陆伟张维
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI