Carbonyl reductase and gene thereof as well as application of carbonyl reductase in asymmetrical reductive carbonyl compound

A technology of carbonyl reductase and reductase, which is applied in the field of bioengineering technology and can solve problems such as poor substrate tolerance, low enzyme catalytic activity, and insufficient product concentration

Active Publication Date: 2012-06-13
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is, in the reaction of reported biocatalytic asymmetric synthesis (R)-2-hydroxyl-4-phenylbutyrate ethyl ester, the enzyme catalytic activity is on the low side, the substrate tolerance is poor, the product The concentration is not high enough, and the need to add additional expensive coenzymes, long reaction time and other problems, provides a carbonyl reductase with high catalytic activity, strong enantioselectivity, good substrate tolerance, short reaction time, and no need to add additional coenzyme , a recombinant expression vector containing the gene, a recombinant expression transformant and a high-efficiency preparation method thereof, and the use of the carbonyl reductase in catalytic reduction of other ketone substrates
[0006] The present invention solves the technical problems existing in the existing biological asymmetric synthesis (R)-2-hydroxy-4-phenylbutyrate ethyl ester through the following technical solutions:

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl reductase and gene thereof as well as application of carbonyl reductase in asymmetrical reductive carbonyl compound
  • Carbonyl reductase and gene thereof as well as application of carbonyl reductase in asymmetrical reductive carbonyl compound
  • Carbonyl reductase and gene thereof as well as application of carbonyl reductase in asymmetrical reductive carbonyl compound

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Cloning of embodiment 1 reductase gene

[0064] According to the gene sequence (Genebank accession number: CAG61069.1) recorded in Genbank and predicted as Candida glabrata reductase, the PCR primers were designed as follows:

[0065] Upstream primer: CGC GGATCC ATGGTTAAGCAAGAATTCTTT;

[0066] Downstream primer: GTG AAGCTT TTAGGCCTTCTGGGACTCTGA.

[0067] Wherein, the underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the HindIII restriction site.

[0068] The genomic DNA of Candida glabrata CGMCC 2.234 was used as a template for PCR amplification. PCR system: 10 μl of 2×Taq PCR MasterMix, 1 μl of upstream primer and downstream primer (0.3 μmol / L), 1 μl of DNA template (0.1 μg) and ddH 2 O 7 μl. PCR amplification steps are: (1) Pre-denaturation at 95°C for 3 minutes; (2) Denaturation at 94°C for 1 minute; (3) Annealing at 55°C for 30 seconds; (4) Extension at 72°C for 1.5 minutes; steps (2) to ...

Embodiment 2

[0069] Embodiment 2 Preparation of recombinant expression vector (plasmid) and recombinant expression transformant

[0070] The reductase gene DNA fragment obtained in Example 1 was double-digested with restriction endonucleases BamHI and HindIII at 37°C for 12 hours, purified by agarose gel electrophoresis, and the target fragment was recovered using an agarose gel DNA recovery kit. Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET28a digested with BamHI and HindIII at 4°C overnight to obtain the recombinant expression plasmid pET-CgKR2.

[0071] Transform the above-mentioned recombinant expression plasmid into Escherichia coli (E.coli) DH5α competent cells, screen the positive recombinants on the resistance plate containing kanamycin, pick a single clone, and the colony PCR verification is positive clone( figure 2 ). Cultivate the recombinant bacteria, extract the plasmid after the plasmid is amplified, retransform into Escherichia co...

Embodiment 3

[0072] Embodiment 3 expression of recombinant reductase

[0073] The recombinant Escherichia coli obtained in Example 2 was inoculated into LB medium containing ampicillin (peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, pH 7.0), cultured with shaking at 37°C overnight, and 1% The inoculation amount of (v / v) is inserted in the 500ml Erlenmeyer flask that 100ml LB culture medium is housed, put 37 ℃, 180rpm shaker shaking culture, when the OD of culture solution 600 When it reached 0.6, IPTG with a final concentration of 0.5 mmol / L was added as an inducer, and after induction at 25°C for 12 hours, the culture medium was centrifuged to collect cells and washed twice with saline to obtain resting cells. The resulting resting cells were suspended in a pH 7.0 buffer, ultrasonically disrupted in an ice bath, and the supernatant was collected by centrifugation, which was the crude enzyme solution of the recombinant reductase. The crude enzyme solution was analyzed by polyacrylamide ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a new carbonyl reductase and gene thereof, a recombinant expression vector containing the gene and a recombinant expression transformant containing the gene, a recombinase of the carbonyl reductase and a preparation method of the recombinase as well as an application of the recombinase serving as a catalyst in preparation of chiral alcohol from prochiral carbonyl compoundssuch as asymmetrical reductive 2-carbonyl-4-phenyl ethyl butyrate. The carbonyl reductase gene disclosed by the invention is derived from candida glabrata, can be used as a catalyst to be applied to preparation of multiple chiral alcohols with optical activities, such as (R)-2-hydroxy-4-phenyl ethyl butyrate. Compared with the other methods for preparing (R)-2-hydroxy-4-phenyl ethyl butyrate, a product obtained by catalysis with the method disclosed by the invention is high in concentration without additional expensive coenzyme; the product is high in optical purity, reaction condition is mild, operation is convenient and easy to amplify. Thus, the carbonyl reductase has a good industrial application prospect in production of an ACEI (Angiotensin-Converting Enzyme Inhibitor) medicament intermediate.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a carbonyl reductase and its gene, a recombinant expression vector containing the gene, a recombinant expression transformant, a recombinase thereof and a preparation method of the recombinase, the carbonyl reductase or Its recombinant enzyme is used as a catalyst in the asymmetric reduction of 2-carbonyl-4-phenylbutyric acid ethyl ester and other prochiral carbonyl compounds to prepare optically active chiral alcohols. Background technique [0002] (R)-2-Hydroxy-4-phenylbutyric acid ethyl ester (molecular formula is C 6 h 5 (CH 2 ) 2 CH(OH)COOCH 2 CH 3 , molecular weight 208.25, CAS number: 90315-82-5) is an important chiral building block for the synthesis of various angiotensin-converting enzyme inhibitors (ACEI) pril drugs, such as benazepril and cilazapril. These drugs are mainly used to treat diseases such as high blood pressure and congestive heart ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/63C12N1/21C12P7/62C12R1/72
Inventor许建和沈乃东钱小龙张杰郑高伟李春秀潘江
OwnerEAST CHINA UNIV OF SCI & TECH