Classical swine fever virus recombinant E2 protein and IgM (immune globulin M) antibody ELISA (enzyme-linked immunosorbent assay) test kit thereof

A swine fever virus and protein technology, applied in the field of molecular biology, to achieve the effect of good repeatability and good antigenicity

Active Publication Date: 2012-07-04
JIANGSU ACAD OF AGRI SCI
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection method of swine fever antibody is mainly based on E2 protein to establish indirect or blocking ELISA and indirect hemagglutination test, but there is no report on the production rule of IgM antibody induced by this protein and the research on its role in immune protection. The present invention aims to establish a detection method The ELISA method of E2 protein IgM antibody lays the foundation for clinical detection and related research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Classical swine fever virus recombinant E2 protein and IgM (immune globulin M) antibody ELISA (enzyme-linked immunosorbent assay) test kit thereof
  • Classical swine fever virus recombinant E2 protein and IgM (immune globulin M) antibody ELISA (enzyme-linked immunosorbent assay) test kit thereof
  • Classical swine fever virus recombinant E2 protein and IgM (immune globulin M) antibody ELISA (enzyme-linked immunosorbent assay) test kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 PCR Amplification of E2 Gene Fragment and Construction of Prokaryotic Expression Plasmid

[0030] 1.1 Primer design

[0031] Primers were designed according to the CSFV gene sequence, and the upstream and downstream primers were respectively introduced Eco RI and Hind Site III, the sequence is as follows:

[0032] F: CCGGAATTCCGGCTGTGCCCGTTTGATACGAGT C (SEQ ID NO. 3);

[0033] R: CAAGCTTGTCTTTAGGTCTGCATGGCATAGG (SEQ ID NO. 4)

[0034] The above primers were synthesized by Nanjing Sipujin Biotechnology Co., Ltd.

[0035] 1.2 PCR amplification of the target fragment

[0036] Take 200 μl of CSF rabbit attenuated vaccine virus (purchased from Nanjing Tianbang Biotechnology Co., Ltd.), add 1ml Trizol reagent, shake and mix, let it stand for 10 minutes, add 200 μl of chloroform, shake vigorously, centrifuge at 12000rpm 4°C for 10 minutes, carefully pipette To the supernatant, add an equal volume of isopropanol and mix well, place at -20°C for 2h, centrifuge a...

Embodiment 2

[0041] Example 2 Construction of recombinant expression strain BL21-△E2

[0042] 2.1 Transformation of competent Escherichia coli BL-21

[0043] In Example 1, the correct recombinant plasmid pET32a-e2 was sequenced and transformed into Escherichia coli BL21 (DE3) (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to obtain the recombinant expression strain BL21-△E2. At the same time, the empty plasmid pET-32a Transform competent Escherichia coli BL-21 in the same way.

[0044] 2.2 Induced expression of recombinant protein

[0045] Single colonies of recombinant expression strain BL21-△E2 and Escherichia coli BL21 containing empty plasmid were picked and inoculated in LB liquid medium containing ampicillin, and cultured overnight at 37°C with shaking.

[0046] (1) Inoculate 10 μL of the overnight cultured bacterial solution into 3 ml LB liquid medium containing ampicillin (50 μg / ml), shake and culture at 200 rpm at 37°C for about 3 hours, and make the OD 600 When it...

Embodiment 3

[0053] Example 3 Mass expression, purification and antigenic identification of recombinant protein

[0054] 3.1 Mass expression and purification of recombinant protein

[0055] Pick the positive colonies of the recombinant expression strain BL21-△E2 in 2.2, inoculate in 200ml LB, induce expression according to the induction expression conditions in Example 2, collect the bacteria by centrifugation, add 5ml of PBS to resuspend the bacteria for every 100ml of bacteria solution, and ultrasonically Centrifuge after lysis, separate the supernatant and inclusion bodies, resuspend the inclusion bodies with an equal volume of Binding buffer, and purify the target protein according to the instructions of GE HisTrap HP affinity purification column ( image 3 ). The protein concentration was determined to be 1.2 mg / mL by spectrophotometer, and stored at -20°C after aliquoting.

[0056] 3.2 Western blot identification of recombinant proteins

[0057] (1) SDS-PAGE;

[0058] (2) Transfe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and relates to a classical swine fever virus recombinant E2 protein and an IgM (immune globulin M) antibody ELISA (enzyme-linked immunosorbent assay) test kit thereof. The classical swine fever virus E2 protein expressed by recombinant Escherichia coli is obtained by cloning the main antigen region of E2 protein into a pronucleus expression vector to obtain a recombinant expression vector, transforming the recombinant expression vector to Escherichia coli BL21 (DE3) and expressing and purifying with the recombinant Escherichia coli. A Westernblot test indicates that the protein has good antigenicity. According to the invention, an elisa plate is coated the protein; an ELISA method is established through optimization of antigen coating concentration, serum dilution and action time, secondary antibody concentration and action time as well as developing time for the purpose of detecting negative serum so as to determine a critical value and a judgment standard. According to the invention, the expression of a recombinant strain constructed by the recombinant E2 protein on a heterologous protein is stable, and the recombinant strain is good in antigenicity; and on the basis, the recombinant E2 protein disclosed by the invention is used for establishing a CSFV (classical swine fever virus) IgM antibody ELISA test kit for the first time.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to an ELISA detection kit for recombinant E2 protein of swine fever virus and IgM antibody of swine fever virus. Background technique [0002] The Escherichia coli expression system is currently a relatively mature expression system, which has the advantages of simple operation, safety and non-toxicity, and high expression of foreign proteins, and has been successfully used in the production of various proteins. E2 protein is the main envelope protein of classical swine fever virus (CSFV), which mediates virus infection into cells and protective immune response, and is the main immune protective antigen of CSFV. At present, the detection method of swine fever antibody is mainly based on E2 protein to establish indirect or blocking ELISA and indirect hemagglutination test, but there is no report on the production rule of IgM antibody induced by this protein and the research on its role ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/18C07K1/22C12N15/40C12N15/70C12N1/21G01N33/68C12R1/19
Inventor李文良毛立江杰元李彬
OwnerJIANGSU ACAD OF AGRI SCI