Rice wine yeast metabolic engineering bacterium low in urea yield and construction method thereof

A rice wine yeast, metabolic engineering technology, applied in the field of microbial genetic engineering, to achieve the effects of reducing urea secretion, low urea production level, and low EC content

Inactive Publication Date: 2012-07-04
JIANGNAN UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Up to now, my country has not formulated EC limit standards for rice wine, wine, etc., but the Ministry of Health has begun to pay attention to this issue in the past two years, and it is believed that the introduction of standards is only a matter of time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice wine yeast metabolic engineering bacterium low in urea yield and construction method thereof
  • Rice wine yeast metabolic engineering bacterium low in urea yield and construction method thereof
  • Rice wine yeast metabolic engineering bacterium low in urea yield and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1, TPI1 p -DUR1,2-TPI1 t Gene cassette construction

[0021] Yeast genome extraction kit was used to extract the total DNA of rice wine yeast genome ( figure 1 ). Utilize the Saccharomyces cerevisiae (S.cerevisiae) standard strain genome sequence database (http: / / www.yeastgenome.org / ) information published on the Internet, design appropriate primers and restriction sites (P1: ACTGAG GAATTC ATGACAGTTAGTTCCGATACAACTGCTG, EcoR I; P2: TCAGGA GGATCC TCATGCCAATGTCTCTATGACGGCCACT, BamH I), with the extracted genomic DNA as template, PCR amplification obtains DUR1, 2 gene coding frame sequence ( figure 2 ), after double-digesting the gene and Escherichia coli-Saccharomyces cerevisiae shuttle plasmid pYX212 (Invitrogen), the recombinant plasmid pYX212-DUR1,2 was constructed by DNA ligation reaction, so that the expression of DUR1,2 was placed in the constitutive high-expression promoter TPI1 of Saccharomyces cerevisiae p TPI1 t under control ( image 3 and ...

Embodiment 2

[0022] Example 2, trp1-TPI1 p -DUR1,2-TPI1 t - Construction of the trp1 gene cassette

[0023] Design primers (P3: TCAGGA CCATGG CATTTAATAGAACAGCATCGT,Nco I;P4:ACTGAG AAGCTT CTTCTGAATCAAACAAG, Hind III), cloned a 1104bp TRP1 gene fragment including the coding frame and part of the upstream and downstream sequences from the rice wine yeast genome, and subcloned it into the vector YRp7 through DNA restriction and ligation reactions to construct the recombinant plasmid YRp7-trp1. Design primers for TPI1 by PCR p -DUR1,2-TPI1 t The restriction site EcoR V was added to both ends of the gene cassette. Simultaneous digestion of YRp7-TRP1 and TPI1 with EcoR V p -DUR1,2-TPI1 t , through DNA ligation, the recombinant plasmid YRp7-(trp1-TPI1 p -DUR1,2-TPI1 t -trp1)( Figure 5 ). By designing head-to-tail primers and performing PCR with the recombinant plasmid as a template, trp1-TPI1 with 562bp and 542bp trp1 homology arms at both ends can be amplified in one step p -DUR1,2...

Embodiment 3

[0024] Embodiment 3, integrated with TPI1 p -DUR1,2-TPI1 t Obtaining engineering strains of gene cassettes

[0025] Linear trp1-TPI1 was transformed by lithium acetate conversion p -DUR1,2-TPI1 t -The trp1 gene cassette fragment and the circular plasmid pUT332 (containing the phleomycin resistance gene) are exogenous DNA, and the two are co-transformed with competent rice wine yeast, and then the transformants are screened with a selection medium plate (YPD+100 μg / mL phleomycin), and the colonies PCR identified TPI1 p -DUR1,2-TPI1 t The gene cassette was successfully integrated into the engineering strain of the TRP1 gene locus, and the correctness of the integrated sequence was confirmed by DNA sequencing ( Figure 6 ). Use non-selective medium (YPD) to continuously subculture yeast engineering strains for 10 generations, and use the phenomenon that the intracellular plasmids of wild-type Saccharomyces cerevisiae are unstable and easy to lose (the loss probability of in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice wine yeast metabolic engineering bacterium low in urea yield and a construction method thereof. The construction method includes: placing an encoding frame of a carbamido amidase gene DUR 1,2 in control of brewing yeast group forming high-expression thermoplastic polyimide 1 (TPI 1) transcription promoters and TPI 1 transcription terminators, and stably integrating TPI 1p-DUR1,2-TPI1t gene cassette in a bacterial strain rice wine yeast bacterial strain genome through homologous recombination to obtain the rice wine yeast metabolic engineering bacterium. The rice wine yeast metabolic engineering bacterium has the remarkable advantage of being low in urea production level, rice wine produced through fermentation of the rice wine yeast metabolic engineering bacterium is low in ethyl cellulose (EC) content and keeps flavor basically unchanged, and therefore the rice wine yeast metabolic engineering bacterium has wide application prospect.

Description

technical field [0001] The invention relates to a yellow wine yeast metabolic engineering bacterium with low urea production and a construction method thereof, belonging to the field of microbial genetic engineering. Background technique [0002] Ethyl Carbamate (EC for short), commonly known as Urethane, has a molecular formula of NH 2 COOC 2 h 5 (CAS#51-79-6). Animal toxicology tests have shown that EC has carcinogenic effects on multiple species (including mice, rats, hamsters, and monkeys), and can cause malignant tumors such as lung cancer, lymphoma, liver cancer, breast cancer, ovarian cancer, and skin cancer in animals. , indicating that EC is a potential human carcinogen. In 1974, EC was classified as Group 2 B carcinogen by the International Agency for Research on Cancer (IARC) under the World Health Organization (WHO); in March 2007, IARC further increased the carcinogenic risk level of EC and classified it into 2 Group A list of carcinogens. [0003] EC is a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12G3/02C12R1/865
Inventor管政兵陆健朱旭亚陈坚周景文
OwnerJIANGNAN UNIV