Rape respiration metabolism-related gene BnAOX1 and application thereof
A gene and amino acid technology, applied in the field of rapeseed respiratory metabolism-related enzyme gene BnAOX1, can solve the problems of unclear signal regulation mechanism and physiological significance, superficial research, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1: BnAOX1, AtAOX1 cDNA coding region sequence
[0033] A method for preparing rapeseed respiratory metabolism-related gene BnAOX1, the steps of which are:
[0034] Search the published Arabidopsis gene sequence in the NCBI database, BLAST the rapeseed EST sequence on the NCBI website, and design primers on both sides of the gene coding sequence based on the Arabidopsis sequence (BnAOX1F: forward primer: [5'-atgatgatgagtcgctacgg-3 '], reverse primer: [5'-tcaatgatccaattggag-3'] is used to amplify the corresponding sequence from the silique cDNA of rapeseed 15 days. The amplification primers in Arabidopsis are: AtAOX1 (arabidopsis website) forward primer : [5'-atgatgatgagtcgtcgcta-3'], reverse primer: [5'-tcaatgatatccaatgggagc-3'], amplified directly in Arabidopsis 10-day silique cDNA.
[0035] 1. Extract rapeseed and Arabidopsis mRNA.
[0036] For RNA extraction (TRIZOL™ Kit for RNA extraction), 100 mg of material was ground with liquid nitrogen.
[0037] A....
Embodiment 2
[0045] Embodiment 2: Construction of transgene expression vector and transformation of Arabidopsis:
[0046] After the gene sequence amplified by PCR was connected to the TOPO entry vector (invitrogen company), it was transformed into competent cell DH5α (invitrogen company), and spectinase screening was carried out. For primers, refer to Example 1 for the sequence of primers. 1) Amplify and identify positively inserted clones. The plasmid is recombined with Pearleygate 100 (Invitrogen) after a small amount of preparation, and transformed into competent cells DH5α, screened with kanamycin, and the inserted fragment Through PCR identification of carrier primers (35S promoter sequence primers, CACGTCTTCAAAGCAAGTGGA) and gene primers (gene downstream primers, see Example 1 for the primer sequence), see the schematic diagram figure 1 .
[0047] Arabidopsis transformation process:
[0048] Reagent preparation:
[0049] Infiltration medium (1L): 1 / 2xMurashige-Skoog; 5% (mass rati...
Embodiment 3
[0056] Example 3: Screening and verification of transgenic Arabidopsis:
[0057] Screening of transformants:
[0058] The vernalized Arabidopsis seeds were planted in the artificial soil watered with the supersaturated Huabao No. 2 (commercially purchased) nutrient solution, and covered with plastic wrap. After two days, the light was exposed, and the film was removed after three days.
[0059] Conditions of artificial culture room: relative humidity 80%, constant temperature 20-24°C, light intensity 80-200umol / M2 / S, light cycle 8h dark, 16h light culture. About a week, spray herbicide (glufosinate) to screen positive plants.
[0060] PCR identification:
[0061] (1) Extraction of transformed plant total DNA for PCR:
[0062] A. 70% (volume ratio) ethanol scrub blade, weigh about 100mg
[0063] B. Add 600ul of extraction buffer (0.2M Tris-Cl, 0.25NaCl, 25mM EDTA, 0.5% (mass ratio) SDS, pH 7.5), and grind rapidly at room temperature.
[0064] C. Vortex in a 1.5ml Ependorf...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com