Unlock instant, AI-driven research and patent intelligence for your innovation.

Functional protein directional fixing method employing SLP

A technology of directional immobilization and protein, which is applied in the field of protein immobilization, can solve the problems of non-directional protein molecules, complicated and violent operation, low activity utilization rate, etc., and achieve the effect of improving activity utilization rate, simple process and improving utilization rate

Active Publication Date: 2012-10-17
BEAVERNANO TECH
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] The protein molecules immobilized by the above methods have no directionality, low activity utilization rate, and there are disadvantages such as weak binding or complex and violent operation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Functional protein directional fixing method employing SLP
  • Functional protein directional fixing method employing SLP
  • Functional protein directional fixing method employing SLP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] A method for directional immobilization of protein A to the surface of magnetic beads. Protein A is a protein present on the cell membrane surface of Staphylococcus aureus, which can specifically bind to the Fc segment of antibodies, and is widely used in the fields of antibody purification and immunoassay. In this example, the fusion expression of the SLP protein and the IgG binding domain (ZZ domain) of protein A is carried out. Specifically include the following steps:

[0055] (1) PCR amplification of the coding gene of SLP protein and protein A:

[0056] To amplify the SLP protein-encoding gene (see SEQ ID NO.7 for the sequence), the template uses the plasmid rSbpA-pUC19 (purchased from Nano-S Biotechnologie, Austria), and the primer pair (the primers already contain restriction enzyme sites) is as follows:

[0057] SLP primer 1: 5`AACCATGGCGCAAGTAAACGACTATAAC (Nco I);

[0058] SLP Primer 2: 5'AA GGATCCTTCTGAATATGCAGTAGTTG (BamHI).

[0059] Amplify the gene enc...

Embodiment 2

[0086] A method for directionally immobilizing protein A on the surface of a cell culture plate, the raw materials and preparation method of which are basically the same as in Example 1, except that the polystyrene cell culture plate is used instead of the magnetic beads wrapped in aminopolyethylene. The obtained polystyrene cell culture plate immobilized with SL-PA fusion protein can be used for immunoassay.

[0087] SL-PA fusion protein embedding human IgG binding ability verification test in cell culture plate:

[0088] 1) Add 200 mL of mouse anti-human IgG-HRP (1 μg / mL, Beijing Boster Company) to the culture wells of the SL-PA fusion protein-embedded cell culture plate, and shake at room temperature for 30 min. The culture wells in which the SL-PA fusion protein was replaced with water and bovine serum albumin (BSA at a concentration of 1 mg / mL, Sigma, USA) for the embedding experiment were used as negative controls.

[0089] 2) Wash the culture well twice with PBST buffe...

Embodiment 3

[0094] A method for directionally immobilizing streptavidin on the surface of magnetic beads (magnetic beads wrapped with aminopolyethylene, with a diameter of 200nm). Streptavidin is a tetrameric protein purified from Streptomyces avidinii, with a size of 52800Da; one molecule of streptavidin can bind to four molecules of biotin with high specificity, The affinity between the two is extremely strong, and the dissociation constant of the streptavidin-biotin complex is in the range of 10 15 M order of magnitude, this high affinity makes it widely used in molecular (DNA, protein) detection; including the following steps:

[0095] (1) PCR amplification of the coding genes of SLP and streptavidin:

[0096] The method and material for amplifying the SLP-encoding gene are the same as in Example 1 step (1);

[0097] Amplify the gene encoding streptavidin, the template sequence is SEQ ID NO.13, which was synthesized by Saiye Biotechnology Co., Ltd., using the following primer pairs ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for fixing a functional protein on a medium surface with a certain direction by using SLP. According to the invention, SLP is modified by using a means of genetic engineering, such that the self-assembly characteristic of SLP is maintained. SLP serves as a fusion expression label, and is subjected to fusion expressions with various functional proteins, such that SLP fusion proteins are obtained. The SLP fusion proteins are then fixed on the medium surface, such that the directional fixing of the functional protein is realized. With the method provided by the invention, the functional protein can be fixed on the medium surface highly orderly and with high-density. The surface of the medium does not need special treatment. The process is simple, and no damage is caused to the functional protein, such that protein activity can be well protected, and the utilization rate of the functional protein activity can be improved.

Description

technical field [0001] The invention belongs to the field of protein immobilization, and in particular relates to a method for directionally fixing specific functional proteins on the surface of a medium by using SLP. Background technique [0002] Bacterial surface self-assembly protein (Crystalline bacterial cell surface layers, S-layers, S-layer protein, SLP) is a protein that exists on the surface of a variety of archaea and bacteria. Stabilizes the cell membrane. Free SLP monomers can pass through electrostatic forces, ionic forces and Hydrophobic forces spontaneously assemble into a regular monolayer grid structure with a thickness of about 5-28nm and grid units with a size of about 3-35nm. This self-assembly property of SLP makes it have great application potential in bionanotechnology. [0003] Functional proteins (such as enzymes, antibodies, antigens, polypeptides, etc.) have a wide range of applications in bioengineering. However, functional proteins are genera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K17/14C07K17/08C07K17/00C12N15/70C12R1/19C12R1/445C12R1/465
Inventor 张曙光乌韦·斯莱泰安德烈亚斯·布韦特莱瑟韩蓝青刘蔼珊罗艳萍任辉
Owner BEAVERNANO TECH