Method for producing cecropins by using alfalfa as bioreactor
A production method and a peptide cecropin technology are applied in the field of producing the antimicrobial peptide Cecropin B (Cecropin B, CB), and can solve the problems of high cost, inability to obtain expression products, host microorganism suicide, and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] The construction of embodiment 1 plant binary expression vector pCAMBIA1390R
[0038] The pCAMBIA1390R plasmid was constructed in this laboratory, with the plant expression vector pCAMBIA1390 as the basic skeleton, and endonuclease xho I and Bgl I was digested with enzymes, and the large fragment of the vector was recovered; it was connected with the cauliflower mosaic virus CaMV35S promoter synthesized in vitro, and a plant expression vector containing the CaMV35S promoter was obtained, which was named pCAMBIA1390R. See pCAMBIA1390R plasmid map figure 1 .
Embodiment 2
[0039] Example 2 Construction and Transformation of Plant Expression Vector pCAMBIA1390R-CB
[0040] 1、 According to the CecropinB base sequence registered on GenBank, the Primer Premier 5.0 software was used to reshape the CB base sequence according to plant-preferred codons, and a single-gene CB was artificially synthesized. The base sequence is shown in the sequence table SEQ ID NO.1. Design primers:
[0041] P1: CGG GGTACC ATGAACTTCGCGAAGATCCT
[0042] P2: AAAACTGCAGTCACTTCCCTATTGCTTTAG
[0043] Artificially synthesized single-gene CB templates were amplified by PCR. PCR reaction conditions: Pre-denaturation at 94.0°C for 5 minutes, denaturation at 94.0°C for 35s, annealing at 65.0°C for 35s, extension at 72.0°C for 35s, 30 cycles, extension at 72.0°C for 2 minutes, and storage at 4°C until the end. After 1% agarose gel electrophoresis detected that the bands were correct and there were no non-specific bands, the PCR cleaning and recovery kit was used to purify a...
Embodiment 3
[0070] Example 3 Plant expression vector pCAMBIA1390R-CB 2 Construct
[0071] 1. Design primers:
[0072] P3: CGG GGTACC AGATCTATGAAC TTCGCGAAGATCCT
[0073] P4: AAAA CTGCAG GGATCCCCTTCCCTATTGCTTTAGCAGAC
[0074] Using its base sequence as shown in the sequence table SEQ ID NO.1, the artificially synthesized single gene CB is used as a template, and the reaction system is according to Table 7;
[0075] Table 7 The first round of PCR reaction system
[0076] Component Volume dNTP Mix 4μl 10× Buffer 5μl Primer P3 1μl Primer P4 1μl Pyrobest DNA polymerase 0.25μl h 2 o 38.75μl Total volume 50μl
[0077] PCR reaction conditions: Pre-denaturation at 94.0°C for 5 minutes, denaturation at 94.0°C for 35s, annealing at 65.0°C for 35s, extension at 72.0°C for 35s, 30 cycles, extension at 72.0°C for 2 minutes, and storage at 4°C until the end. After 1% agarose gel electrophoresis detected that the bands were corr...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com