Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for producing cecropins by using alfalfa as bioreactor

A production method and a peptide cecropin technology are applied in the field of producing the antimicrobial peptide Cecropin B (Cecropin B, CB), and can solve the problems of high cost, inability to obtain expression products, host microorganism suicide, and the like

Inactive Publication Date: 2012-11-14
JILIN AGRICULTURAL UNIV +1
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chemically synthesized peptides, the cost is high
However, direct expression of antimicrobial peptide genes in microorganisms may cause the host microorganisms to commit suicide and fail to obtain expression products.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing cecropins by using alfalfa as bioreactor
  • Method for producing cecropins by using alfalfa as bioreactor
  • Method for producing cecropins by using alfalfa as bioreactor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The construction of embodiment 1 plant binary expression vector pCAMBIA1390R

[0038] The pCAMBIA1390R plasmid was constructed in this laboratory, with the plant expression vector pCAMBIA1390 as the basic skeleton, and endonuclease xho I and Bgl I was digested with enzymes, and the large fragment of the vector was recovered; it was connected with the cauliflower mosaic virus CaMV35S promoter synthesized in vitro, and a plant expression vector containing the CaMV35S promoter was obtained, which was named pCAMBIA1390R. See pCAMBIA1390R plasmid map figure 1 .

Embodiment 2

[0039] Example 2 Construction and Transformation of Plant Expression Vector pCAMBIA1390R-CB

[0040] 1、 According to the CecropinB base sequence registered on GenBank, the Primer Premier 5.0 software was used to reshape the CB base sequence according to plant-preferred codons, and a single-gene CB was artificially synthesized. The base sequence is shown in the sequence table SEQ ID NO.1. Design primers:

[0041] P1: CGG GGTACC ATGAACTTCGCGAAGATCCT

[0042] P2: AAAACTGCAGTCACTTCCCTATTGCTTTAG

[0043] Artificially synthesized single-gene CB templates were amplified by PCR. PCR reaction conditions: Pre-denaturation at 94.0°C for 5 minutes, denaturation at 94.0°C for 35s, annealing at 65.0°C for 35s, extension at 72.0°C for 35s, 30 cycles, extension at 72.0°C for 2 minutes, and storage at 4°C until the end. After 1% agarose gel electrophoresis detected that the bands were correct and there were no non-specific bands, the PCR cleaning and recovery kit was used to purify a...

Embodiment 3

[0070] Example 3 Plant expression vector pCAMBIA1390R-CB 2 Construct

[0071] 1. Design primers:

[0072] P3: CGG GGTACC AGATCTATGAAC TTCGCGAAGATCCT

[0073] P4: AAAA CTGCAG GGATCCCCTTCCCTATTGCTTTAGCAGAC

[0074] Using its base sequence as shown in the sequence table SEQ ID NO.1, the artificially synthesized single gene CB is used as a template, and the reaction system is according to Table 7;

[0075] Table 7 The first round of PCR reaction system

[0076] Component Volume dNTP Mix 4μl 10× Buffer 5μl Primer P3 1μl Primer P4 1μl Pyrobest DNA polymerase 0.25μl h 2 o 38.75μl Total volume 50μl

[0077] PCR reaction conditions: Pre-denaturation at 94.0°C for 5 minutes, denaturation at 94.0°C for 35s, annealing at 65.0°C for 35s, extension at 72.0°C for 35s, 30 cycles, extension at 72.0°C for 2 minutes, and storage at 4°C until the end. After 1% agarose gel electrophoresis detected that the bands were corr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for producing cecropins by using alfalfa as a bioreactorand discloses a cecropin B (CB) and a hybrid cecropin B (CB2 and CB3). The method includes inserting a CaMV35S promoter in a plant expression body pCAMBIA1390 to obtain pCAMBIA1390R; inserting CB, CB2 and CB3 genes respectively, and transforming the plant expression body into the alfalfa through the agrobacterium mediated transformation to obtain a transgenic alfalfa. The experiment shows that the CB, CB2 and CB3 genes are integrated into a genome of the alfalfa, the transgenic alfalfa has inhibitory activities to staphylococcus aureus and salmonella, but wild alfalfas do not have inhibitory activities, and the bacteriostatic activity of a CB3 transgenic plant is the highest. The alfalfa has the advantages of strong stress resistance, wide applicable range, long utilization periods, strong reproducibility and multiple harvest times each year. As an antibacterial peptide gene is transformed into the transgenic alfalfa, the disease resistant capability is improved; the cost for producing the cecropin B is greatly reduced by using the transgenic alfalfa as a bioreactor.

Description

technical field [0001] The invention relates to the field of biology, in particular to a method for producing antibacterial peptide cecropin B (Cecropin B, CB) using alfalfa as a bioreactor. Background technique [0002] Antibacterial peptides (antibacterial peptides, ABP) are a class of small molecular polypeptides widely present in organisms that can resist external microbial invasion and eliminate mutant cells in the body, consisting of 20 to 60 amino acid residues. Most of these active peptides have the characteristics of strong alkalinity, thermal stability, and broad-spectrum antibacterial properties, and are an important part of the natural immune defense system of organisms. [0003] Cecropins are the first antimicrobial peptides that have been found to be relatively clear at present. They exist widely in animals and are one of the most promising alternatives to antibiotics. Cecropins have strong lethality to Gram-positive bacteria and some Gram-negative bacteria, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/62C07K14/435A01H5/00
Inventor 刘秀明李海燕李校堃杜淑环万秋
Owner JILIN AGRICULTURAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More