Cyprinidherpesvirus 2 (CyHV-2) nested PCR (polymerase chain reaction) detection kit
A carp herpes virus and detection kit technology, applied in the determination/testing of microorganisms, methods based on microorganisms, microorganisms, etc., to achieve accurate and reliable results, improve detection sensitivity, and simplify detection procedures
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037]A nested PCR detection kit for carp herpesvirus type 2, including a box body (1), and six 1.5mL centrifuge tubes containing reagents are placed on the liner (2), including 10× reaction buffer (3 ), Taq enzyme (1U / μL) (4), primer P1 (containing CyHV-2P1F, CyHV-2P1R each 10 μM) (5), primer P2 (containing CyHV-2P2F, CyHV-2P2R each 10 μM) (6), pure Water (molecular biology grade) (7), positive DNA (10μg / mL) (8).
[0038] The formula of the 10× reaction buffer is: Tris-HCl 100mM, KCl 500mM, MgCl 2 15mM, dNTPs 2mM.
[0039] Described Tris-HCl is trihydroxymethylaminomethane hydrochloride; KCl is potassium chloride; MgCl 2 It is magnesium chloride; dNTPs is an equal-volume mixture of four deoxynucleotides required for DNA synthesis.
[0040] The various liquid reagents mentioned above are respectively packed in 1.5mL centrifuge tubes and placed in boxes.
[0041] Described primer nucleotide sequence is:
[0042] CyHV-2P1F is: TGAAATGTCAAAAAGTGGATGG
[0043] CyHV-2P1R is: ...
Embodiment 2
[0047] A nested PCR detection kit for carp herpesvirus type 2, comprising a box body 1, 6 1.5mL centrifuge tubes filled with reagents are placed on the box inner liner 2, including 10× reaction buffer 3, Taq enzyme (1U / μL) 4, primer P1 (including CyHV-2P1F, CyHV-2P1R each 10 μM) 5, primer P2 (including CyHV-2P2F, CyHV-2P2R each 10 μM) 6, pure water (molecular biology grade) 7, positive DNA ( 10 μg / mL) 8.
[0048] The formula of the 10×reaction buffer is: Tris-HCl 100mM, KCl 500mM, MgCl 215mM, dNTPs 2mM.
[0049] Described Tris-HCl is trihydroxymethylaminomethane hydrochloride; KCl is potassium chloride; MgCl 2 It is magnesium chloride; dNTPs is an equal-volume mixture of four deoxynucleotides required for DNA synthesis.
[0050] The using method of described kit comprises the following steps:
[0051] 1) Extraction of DNA from test samples before testing: Take an appropriate amount of gill filaments, spleen, and kidney tissues of dying diseased fish, homogenize them with a...
Embodiment 3
[0061] Detection of five naturally infected diseased fish tissue samples:
[0062] Randomly select crucian carp with typical symptoms, take an appropriate amount of gill tissue and homogenize it in a glass homogenizer, take 0.25 mL of the homogenate supernatant and use DNAzol to extract the virus DNA template, and use the reagents in the kit for nested PCR detection. The test results were analyzed by 1% (W / V) agarose gel electrophoresis and imaging system. The results show that (attached figure 2 ), the five crucian carp samples tested were all positive for CyHV-2, which was completely consistent with the observation results of electron microscope ultrathin sections.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
