Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus firmus for killing plant parasitic nematodes, and preparation method and application thereof

A technology of bacillus and nematodes, applied in the field of bacillus firmus and its preparation, can solve the problems of strong killing ability, difficult selection process of resistant varieties, poor selectivity, etc., achieve strong ecological adaptability, maintain insecticidal virulence, and long-lasting effect

Inactive Publication Date: 2013-01-16
HUNAN NORMAL UNIVERSITY
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are mainly three methods for preventing and controlling plant parasitic nematodes: chemical control, agricultural measures, and breeding of resistant varieties. Chemical control methods have disadvantages such as large waste, poor selectivity, polluting the environment, strong extinction, and destroying soil biota. The control effect of agricultural measures is not good, and the selection process of resistant varieties is relatively difficult. These methods of nematode control have various disadvantages, and the effect is not ideal, which makes the nematode damage more and more serious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus firmus for killing plant parasitic nematodes, and preparation method and application thereof
  • Bacillus firmus for killing plant parasitic nematodes, and preparation method and application thereof
  • Bacillus firmus for killing plant parasitic nematodes, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] This embodiment includes Bacillus firmus wild-type strain Bacillus firmus The separation and Gram staining of YBf-10, the following is the specific implementation process: collect seabed mud from near the southern islands and reefs in the South China Sea, at an altitude of -812 meters, east longitude 115°29.4, north latitude 09°51.76, and use sterile water in the laboratory Suspend, heat to 80°C, use an inoculation loop to dip the suspension in LB solid medium (yeast powder 5 g, peptone 10 g, sodium chloride 10 g, agar powder 20 g, dissolve in 1 L single distilled water, 121°C , 20 min condition damp heat sterilization) was diluted and streaked for isolation, cultured at 28°C for 48 hours, picked a suspected single colony from the plate, diluted and streaked again on the LB plate, cultured at 28°C for 48 hours, and separated repeatedly The purified suspected single colonies were inoculated into LB liquid medium shake flasks, cultured at 28°C, 180 rpm, for 36 h, and 50...

Embodiment 2

[0038]In this embodiment, the 16S rRNA gene is obtained by using the isolated bacterial strain, and the phylogenetic tree is constructed. The specific implementation process is as follows: Bacillus firmus YBf-10 strain was activated overnight, inoculated with 1% (V / V) inoculum into fresh LB medium (Sambrook et al., 1989), and cultivated to OD 600 =0.3, collect the cells by centrifugation, and extract genomic DNA according to the operation method of TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit ver. 2.0. Using the genomic DNA as a template, bacterial 16S rRNA universal primers (27f: AGAGTTTGATCCTGGCTCAG; 1492r: ACGGCTACCTTGTTACGACTT) were used to amplify. The PCR reaction system was (25 L): 10× amplification buffer (with Mg 2+ 1.5mmol / L) 2.5 L, dNTP 0.5 L, each primer concentration is 0.2 L, template DNA 0.1 L, Taq DNA polymerase 0.1 L, add double distilled water to 25 L; Amplification conditions: pre-denaturation at 94°C for 4 min, denaturation at 94°...

Embodiment 3

[0042] The specific implementation process of this embodiment:

[0043] (1) Strain culture and bioassay sample preparation: cultured in LB medium (pH 7.0) Bacillus firmus The spores of YBf-10 strain were fully mature after 36 h. During this period, 2 mL samples were taken at different intervals until the spores were fully mature. The samples taken at each period were measured for OD 600 The growth curve was drawn, and the supernatant was collected by centrifugation to remove the spores. use 0.2 m membrane filter and save for biological assay samples.

[0044] (2) Obtaining the second instar larvae of M. northernis: Meloidogyne hapla ) (Greenhouse Artificial Culture and Propagation) severely infected tomato roots, rinse the surface sediment with tap water, remove the egg mass from the root with pointed tweezers, disinfect the surface of the egg mass with 0.5% (V / W) NaClO for about 5 min, and then use Rinse with sterile water repeatedly. After incubation at 25°C for 4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to blastema firmus for killing plant parasitic nematodes, and a preparation method and an application thereof. The blastema firmus for killing the plant parasitic nematodes is a wild type strain of the blastema firmus YBf-10 which is preserved in China Center for Type Culture Collection in June 14th, 2012, with a preservation number of CCTCCNO. M2012233. The invention also provides the preparation method and the application of blastema firmus for killing the plant parasitic nematodes. Metabolic product of the blastema firmus YBf-10 is prepared by the fermentation of the blastema firmus YBf-10 in a common bacteria culture medium, and can be applied to kill root-knot nematodes. A corrected mortality rate of 24 h is over 50% and the corrected mortality rate of 72 h can reach 100% when the metabolic product acts on second-stage larvas; and inhibited egg hatching rate of 48 h is over 80% when the metabolic product acts on the eggs of the root-knot nematodes.

Description

technical field [0001] The invention relates to a bacillus firmus and its preparation method and application, in particular to a bacillus firmus with activity of killing plant parasitic nematodes and its preparation method and application. Background technique [0002] Plant parasitic nematodes are an important class of plant pathogens that seriously endanger agricultural and forestry production worldwide. It is estimated that plant parasitic nematodes cause losses of more than 120 billion US dollars to agricultural and forestry production worldwide every year. [0003] Because plant parasitic nematodes are small in size, hidden in danger, and mostly live in plants or in soil, it is extremely difficult to control them. while root-knot nematodes ( Meloidogyne spp.) is the nematode with the widest range of damage and the most serious agricultural loss among plant parasitic nematodes. It can parasitize about 1700 kinds of plants, and its damage range is all over the world. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/02A01P5/00C12R1/07
Inventor 余子全夏立秋熊静罗辉张超胡胜标
Owner HUNAN NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com