Amphioxus agglutinoid and expressed genes and application thereof

A lectin-like, gene expression technology, applied in the field of genetic engineering, can solve problems such as hindering the rapid development of marine aquaculture

Inactive Publication Date: 2013-02-13
SHANDONG UNIV
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, diseases have seriously hindered the rapid development of mariculture industry for many years

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amphioxus agglutinoid and expressed genes and application thereof
  • Amphioxus agglutinoid and expressed genes and application thereof
  • Amphioxus agglutinoid and expressed genes and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Cloning of the gene encoding the lectin AmphiITLN239631 of Wenchang fish in Qingdao:

[0032] 1.1 For the extraction of Qingdao amphioxus total RNA and the synthesis of first-strand cDNA, the extraction and synthesis steps refer to the relevant kit instructions of Takara and TIANGEN companies.

[0033] 1) Cut 100mg of fresh tissue (adult amphioxus) as much as possible into a pre-1.5mlep tube.

[0034] 2) Add 1ml Trizol (Invitrogen), quickly grind the tissue with a grinding pestle until there are no large tissue pieces, and let stand at room temperature for 5 minutes to fully lyse the tissue. At this time, the samples can be stored at -80°C for long-term storage.

[0035] 3) Add 0.2ml of chloroform (chloroform) to every 1ml of Trizol, cover and seal tightly, shake vigorously for 15s, and let stand at room temperature for 15 minutes.

[0036] 4) Centrifuge at 1000g for 15min at 4°C. At this time, the sample is divided into three layers: the red organic phase of the low...

Embodiment 2

[0056] Gene sequence determination

[0057] 2.1. Ligation of DNA fragments to cloning vectors

[0058] The recovered DNA fragments were connected to the pEASY-T3 vector of Transgene Company. Ligation reaction system: 1 μl of ligation carrier enzyme mixture, 4 μl of foreign DNA fragments, flick the centrifuge tube with your finger, mix the sample evenly, turn it on the centrifuge for 2 seconds, concentrate the sample at the bottom of the tube, and ligate at 37°C for 5 minutes.

[0059] 2.2. Prepare Escherichia coli DH5α competent according to the method for preparing Escherichia coli competent in "Molecular Cloning Experiment Guide".

[0060] 2.3. Transfer the ligated recombinant vector pEASY-T3 to Escherichia coli DH5α competent according to the heat shock transformation method in the "Molecular Cloning Experiment Guide".

[0061] 2.4. The transformed Escherichia coli DH5α was spread on MacConkey medium containing 100 μg / L ampicillin, cultured overnight at 37°C, and the ...

Embodiment 3

[0066] Heterologous Expression and Purification of Lectin-like AmphiITLN239631

[0067] 3.1 Construction of expression vector pET29b-AmphiITLN239631

[0068] 1) Using the small-dose plasmid extraction kit, follow the steps in the instructions to extract the recombinant plasmid pEASY-T3-AmphiITLN239631 from the transformant containing the recombinant plasmid pEASY-T3.

[0069] 2) Design two specific primers according to the sequencing results:

[0070] pET29b-Amphi239631-F: 5'GAATTCCATATGACGCCCGAGG 3' and

[0071] pET29b-Amphi239631-R: 5' CCGCTCGAGACGGTAAAAGAAG,

[0072] The above primers were synthesized by Shanghai Boshang Biotechnology Company.

[0073] 3) The gene sequence was amplified by PCR, using pET29bAmphiITLN239631-F and pET29b-AmphiITLN239631-R as primers, and the recombinant plasmid pEASY-T3-AmphiITLN239631 as a template for PCR amplification. The PCR reaction conditions were: 95°C, 5 minutes; 95°C, 1 minute; 55°C, 1 minute; 72°C, 2 minutes, after 35 cycles, 72...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to amphioxus agglutinoid and expressed genes and application thereof. An expressed gene nucleotide sequence of the amphioxus agglutinoid AmphiITLN239631 is shown as SEQ ID NO.1. An amino acid sequence of the amphioxus agglutinoid AmphiITLN239631 is shown as SEQ ID NO.2. The amphioxus agglutinoid AmphiITLN239631 can be combined with polysaccharide to prepare a bacteria- polysaccharide- agglutinoid recognized chip and provides theory basis for quick identification and prevention treatment of mariculture diseases caused by bacterial infection.

Description

technical field [0001] The invention relates to an amphioxus lectin and its expression gene and application, in particular to a marine model organism amphioxus lectin AmphiITLN239631 and its expression gene and application, belonging to the technical field of genetic engineering. Background technique [0002] Lectins are a class of proteins that can specifically recognize polysaccharides on the surface of bacteria, and can participate in the immune defense response caused by pathogenic bacteria in the host through agglutination, embedding, and opsonophagocytosis. Lectin (Intelectin) is a newly discovered lectin. Compared with traditional lectin, lectin does not have the traditional carbohydrate recognition domain (CRD) structurally, but has fibrinogen at the N-terminus. The domains of βchain and γchain (FReD) have an Intelectin domain at the C-terminus. The earliest discovered member was XL35 from Xenopus laevis. Monosaccharide-specific binding experiments showed that XL35...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/63C12N1/21C12N1/20
Inventor冯力骏闫杰王建峰刘欢欢荆韧威李开霖刘凯兴张妍董璇张长青孔雨
OwnerSHANDONG UNIV