Herpes virus EBV (Epstein-Barr Virus) detection kit

A detection kit and kit technology, applied in the direction of microbial determination/inspection, fluorescence/phosphorescence, biochemical equipment and methods, etc., can solve the problem of low detection sensitivity, achieve high detection sensitivity, wide detection range, and fast operation Effect

Active Publication Date: 2014-08-27
SANSURE BIOTECH INC
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, kits for quantitative detection of EBV-DNA based on real-time fluorescent quantitative PCR technology have been used in clinical detection at home and abroad, but most of these kits use the boiling method to extract nucleic acid, and the detection sensitivity is not high, about 5000copies / ml

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Herpes virus EBV (Epstein-Barr Virus) detection kit
  • Herpes virus EBV (Epstein-Barr Virus) detection kit
  • Herpes virus EBV (Epstein-Barr Virus) detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] The present embodiment provides a specific EBV detection kit, which includes the following components:

[0025] ① EBV concentrate: Contains 50mM / L polyethylene glycol 6000 (PEG-6000) and 100mM / L sodium chloride.

[0026] ② Nucleic acid release agent: Contains 0.1mM / L of surfactin, 100mM / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), 0.1% of ethanol and solvent TE buffer.

[0027] ③ Internal standard (positive internal control): It is a recombinant of a 100 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, the concentration is 2.00E+05copies / ml, and the 100 base pair sequence is: 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTC GTAGCCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'.

[0028] ④PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for target polynucleoti...

Embodiment 2

[0034] This example provides the operation steps for detecting EBV-DNA in unknown samples such as plasma, throat swab, and peripheral blood using the kit described in Example 1 above:

[0035] 1. Reagent preparation

[0036] According to the number of samples to be tested, EBV negative control, EBV positive control, and EBV quantitative reference products A~D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) and content in proportion. Label 1.0 μl / person and mix thoroughly to form a PCR-mix. For example, when the sample to be tested is 3 people, a total of 9 people need to be prepared (the number of people in the above four is 3, 1, 1 and 4 respectively). PCR-mix; ready for use after brief centrifugation.

[0037] 2. Nucleic acid extraction

[0038] 1. Plasma sample: Take 100 μl of plasma sample, add an equal volume of EBV concentrate, centrifuge at 12,000 rpm for 5 minutes, discard the supernatant, add 50 μl of nucleic acid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a herpes virus EBV (Epstein-Barr Virus) detection kit. The kit comprises a nucleic acid releasing agent and PCR (polymerase chain reaction) reaction solution, wherein the nucleic acid releasing agent comprises 0.01-0.5 mM / L of surfactin, 20-300 mM / L of potassium chloride, 0.01-2% of sodium dodecyl sulphate and 0.05-1% of ethanol; and the PCR reaction solution comprises an upstream primer and a downstream primer used for target polynucleotide amplification, and a probe used for target polynucleotide detection. The detection result of the method for releasing nucleic acid by the nucleic acid releasing agent in the kit disclosed by the invention has no obvious difference with the detection result of a boiling method, a strong protein denaturing agent is used during nucleic acid extraction in the kit disclosed by the invention for rapidly breaking the coat protein structure of a pathogen and releasing the nucleic acid of the pathogen, and release and extraction for DNA (deoxyribonucleic acid) can be rapidly finished without heating; the sensitivity of the EBV detection of the kit disclosed by the invention can achieve 400 copies / ml, and the quantitative linear range is 400-4.00E+09 copies / ml; by applying the kit, rapid and accurate detection can be performed on EBV-DNA in the unknown samples of blood plasma, throat swab, peripheral blood and the like, and reliable experimental basis is provided for diagnosing EBV infection.

Description

technical field [0001] The invention provides a herpes-like virus Epstein-Barr virus (EBV) detection kit, in particular a fluorescent PCR-based EBV-DNA detection kit. Background technique [0002] EBV is a herpes virus ubiquitous in the human body. Once a person is infected, he may carry it for life. EBV infection mainly causes infectious mononucleosis in children and is closely related to the occurrence of many tumors, which seriously threatens the health of human beings, especially children, so it has always been concerned. [0003] Clinical detection of the presence of Epstein-Barr virus in the human body is of great value to the early diagnosis of human tumors. Due to the difficulty in the isolation and culture of EBV, serological methods and molecular biological methods are generally used in clinical diagnosis. Serological methods mainly use enzyme-linked immunosorbent assay or immunofluorescence technology to detect specific EBV antibodies in serum, but the detection...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64
Inventor戴立忠邓中平吴康
OwnerSANSURE BIOTECH INC