Kit for detecting human cytomegalovirus (HCMV)

A human cytomegalovirus and detection kit technology, which is applied in the direction of microbial determination/inspection, microorganisms, biochemical equipment and methods, etc. The effect of high detection sensitivity and wide detection range

Active Publication Date: 2013-05-29
SANSURE BIOTECH
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, kits for the quantitative detection of HCMV-DNA based on real-time fluorescent quantitative PCR technology have been used in clinical detection at home and abroad, but most of these kits use the boiling method to extract nucleic acids, and the

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting human cytomegalovirus (HCMV)
  • Kit for detecting human cytomegalovirus (HCMV)
  • Kit for detecting human cytomegalovirus (HCMV)

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0023] Example 1

[0024] This embodiment provides a specific human cytomegalovirus detection kit, which includes the following components:

[0025] ①HCMV Concentrate: Contains 50mM / L polyethylene glycol 6000 (PEG-6000) and 100mM / L sodium chloride.

[0026] ② Nucleic acid release agent: Contains 0.1mM / L of surfactin, 100mM / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), 0.1% of ethanol and solvent TE buffer.

[0027] ③ Internal standard (positive internal control): It is a recombinant of a 100 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, the concentration is 2.00E+04copies / ml, and the 100 base pair sequence is: 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTCGTAGCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'.

[0028] ④PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L ...

Example Embodiment

[0033] Example 2

[0034] This embodiment provides the operation steps of the kit described in the above-mentioned embodiment 1 for detecting HCMV-DNA in unknown samples such as serum, urine and peripheral blood:

[0035] 1. Reagent preparation

[0036] According to the number of samples to be tested, HCMV negative control, HCMV positive control, and HCMV quantitative reference materials A~D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) and content in proportion. Label 1.0 μl / person and mix thoroughly to form a PCR-mix. For example, when the sample to be tested is 3 people, a total of 9 people need to be prepared (the number of people in the above four is 3, 1, 1 and 4 respectively). PCR-mix; ready for use after brief centrifugation.

[0037] 2. Nucleic acid extraction

[0038] 1. Urine sample: Take 1ml sample, centrifuge at 12,000rpm for 5 minutes, discard the supernatant, add 50μl of nucleic acid release agent to the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a kit for detecting a human cytomegalovirus (HCMV). The kit contains a nucleic acid releasing agent and a PCR (Polymerase Chain Reaction) liquid; the nucleic acid releasing agent contains 0.01-0.5mM/L of surfactin, 20-300mM/L of potassium chloride, 0.01-2% of sodium dodecyl sulfate and 0.05-1% of ethanol; and the PCR liquid contains an upstream primer and a downstream primer which are used for amplifying target polynucleotide and a probe for detecting the target polynucleotide. The sensitivity of the kit for detecting the HCMV can be up to 400copies/ml, and the kit has the quantitative linearity range of 400-4.00E+09copies/ml; and by using the kit, the HCMV-DNA in an unknown sample such as serum, urine, peripheral blood and the like can be rapidly and accurately detected, the reliable experiment basis can be provided for good birth and good care as well as the early diagnosis of HCMV infection.

Description

technical field [0001] The invention provides a human cytomegalovirus HCMV detection kit, in particular a fluorescent PCR-based HCMV-DNA detection kit. Background technique [0002] Human cytomegalovirus (HCMV), also known as cell inclusion body virus, is a double-helical DNA virus of the genus β in the family Herpesviridae. Because the infected cells are enlarged and have huge nuclear inclusion bodies, they are called giant cells Virus. CMV can infect humans and other mammals, but has a high degree of host specificity, and humans are the only host of HCMV. Most people have been infected with HCMV, but most of them are acute infection or latent infection without clinical symptoms, and most of them acquire immunity due to infection in childhood. HCMV is an opportunistic pathogenic virus. The virus can remain latent in the body for a long time, and even carry the virus for life. However, in people with immature or deficient immune functions (such as AIDS and organ transplant...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 戴立忠邓中平艾颖娟
Owner SANSURE BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap