Mannase and mutants thereof

A mannanase, mutant technology, applied in the field of microbial engineering, can solve problems such as difference in activity

Active Publication Date: 2013-07-03
QINGDAO VLAND BIOTECH GRP
View PDF3 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the homology of these mutants is very high, there are large differences in activity (specific activity) between each other

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mannase and mutants thereof
  • Mannase and mutants thereof
  • Mannase and mutants thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Cloning of Bacillus licheniformis mannanase gene

[0045] 1.1 Extraction of total genomic DNA from different strains of Bacillus licheniformis

[0046] Cultivate the 6 strains of Bacillus licheniformis preserved in our laboratory overnight, take 1.5ml each, centrifuge at 12000rpm for 1 minute, remove the supernatant; add 200μl lysis buffer (60mM Tris-HCl, pH7.8, 20mM Na-Ac, 1mM EDTA , 1.5% SDS), blow vigorously with a pipette; add 66μl 5M sodium perchlorate solution to mix, centrifuge at 12000rpm for 10 minutes, and take the supernatant; add an equal volume of phenol to extract once, centrifuge at 12000rpm for 2 minutes, and take the supernatant; Add an equal volume of isopropanol to precipitate for 5 minutes, centrifuge at 12000rpm for 5 minutes; wash twice with 70% ethanol; finally dissolve the dried DNA in ddH 2 O.

[0047] gene cloning

[0048] Using the total genomic DNA extracted in 1.1 as a template, PCR amplification was performed using primer...

Embodiment 2

[0051] Example 2 Sequence Analysis of Mannanase

[0052] BLAST analysis of the sequencing results on NCBI showed that these sequences were highly homologous to the mannanase gene. Using the biological software DNAMAN6.0 to analyze the nucleic acid sequences, it was found that the six sequences were not completely homologous. The corresponding nucleic acid sequences were translated into amino acid sequences and named as Man1, Man2, Man3, Man4, Man5 and Man6, respectively. The amino acid sequence homologous comparison analysis shows that there are mutations at one or more of the following positions, namely: 20, 27, 31, 48, 64, 78, 81, 89, 102, 105, 122, 123, 179 , 187, 195, 234, 248, 254, 255, 292, 302, 312, 313 and 325 positions. Possible substitutions for amino acid residues at these positions are Y20N, D27N, N31 S, L48 T, V64I, E78 K, V81D, S89R, R102Q, L105M, S122P, S123N, S179T, A187E, R195Q, H234Y, H248Y, D254E, Q255E, N292K, G302E, G312D, A313T, D325E, the results of...

Embodiment 3

[0053] Example 3 Recombinant expression and purification of mannanase in Escherichia coli

[0054] Using the plasmids pMDT-Man1, pMDT-Man2, pMDT-Man3, pMDT-Man4, pMDT-Man5 and pMDT-Man6 as templates, primers (AGA GCTAGC GCACACACCGTTTCTCCGGTG --- Nhe I and ACA CTCGAG CACGACAGGCGTCAAAAGAATCG--- xho I) Carry out PCR amplification. The PCR amplification conditions are 95°C for 4min; 94°C for 30S; 55°C for 40S; 72°C for 1min for 30 cycles; 72°C for 7min. After the gel recovery of the amplification products, the first Nhe I digest, and then recover the digested product to carry out xho I digestion. Similarly, the expression plasmid pET28a was also carried out separately Nhe I digestion and xho I digestion. The cloned gene and the expression vector were ligated overnight at 4°C with T4 ligase. Finally, the ligated product was introduced into E. coli BL21. The expression plasmids of the corresponding positive clones were named pET-Man1, pET-Man2, pET-Man3, pET-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of microbial engineering and provides mannase with a high enzyme activity and mutants thereof. According to the mannase and the mutants thereof, six mannase genes obtained by cloning different strains of Bacillus licheniformis and encoded mannase of the mannase genes, difference and genetic relationships among the six mutants are analyzed by bioinformatics. The mannose has the high enzyme activity in a neutral pH condition, and can be used as a feed enzyme preparation in an optimum temperature.

Description

[0001] This application is a divisional application of the invention patent application of "mannanase and its mutant" with the filing date of August 16, 2011 and the application number of 201110234218.X. technical field [0002] The invention relates to mannanase and its mutants, belonging to the technical field of microbial engineering. Background technique [0003] β-1, 4-D-mannanase (EC 3.2.1.78), also known as mannanase, can hydrolyze β-1, 4-D-mannosidic bonds to produce mannan oligosaccharides or mannan polysaccharides, Belongs to hemicellulase. [0004] In nature, mannan is the second largest renewable hemicellulose carbohydrate after cellulose, widely present in plant cell walls, especially in legume seeds, where the content of galactose-mannan is as high as dry More than 20% of the weight. At the same time, there are many structures of mannan, such as galactose-mannan, glucose-mannan and galactose-glucose-mannan. The structure of galactose-mannan is mannan whose m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/19C12N1/21
Inventor黄亦钧程斯达许韡王华明陈亮珍刘鲁民陈刚
OwnerQINGDAO VLAND BIOTECH GRP