Primer-mediated cyclized constant-temperature nucleic acid rolling circle amplification method and kit

A rolling circle amplification and cyclization technology, applied in biochemical equipment and methods, microbial assay/inspection, etc., can solve the problem of not being able to be completed at one time

CN103255227AActive Publication Date: 2013-08-21QUICKING BIOTECH
2 Cites 35 Cited by

Patent Information

Authority / Receiving Office
CN · China
Current Assignee / Owner
Publication Date
2013-08-21

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a primer-mediated cyclized constant-temperature nucleic acid rolling circle amplification method and a kit. The method comprises the following steps of: 1) designing an oligonucleotide sequence; 2) amplifying a single-stranded DNA (deoxyribonucleic acid) target template from target nucleic acid; 3) cyclizing the DNA target template through a DNA ligase; and 4) performing rolling circle amplification on the cyclized DNA target template. According to the method disclosed by the invention, a long padlock probe with high cost does not need to be synthesized, the length of the sequence of the target nucleic acid can be allowed to be longer, the rolling circle amplification can be performed on any sequence of the target nucleic acid, a solution can be provided for preventing a sample from being polluted by an amplified product, and a new era that gene detection enters applications in basic level units is opened.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The present invention relates to a nucleic acid sequence constant temperature amplification method and kit, more specifically, to a constant temperature nucleic acid rolling circle amplification method for primer-mediated circularization, that is, two primer-related sequences for preparing single-stranded DNA strands A method and a kit (Primer mediated Rolling Circle Amplification, PRCA) capable of initiating constant temperature rolling circle amplification with at least two primers connected to form a circle at the ends. Background technique

[0002] In 1985, the U.S. Cetus company used Polymerase Chain Reaction (Polymerase Chain Reaction, PCR) technology to realize the in vitro amplification of nucleic acid for the first time, which played a very important role in the development of modern molecular biology. A revolutionary initiative and milestone in the field of medicine. However, the PCR method still has deficiencies such as: the double-stranded...

Examples

Embodiment 1

[0078] Example 1: Bridge hairpin primer BHP-RCA detects double-stranded DNA

[0079] In this example, a bacterial culture of Listeria monocytogenes was used as a sample. Bacteria were purchased from ATCC (ATCC19116). Take 1 μL of the original seed solution into 3 ml of TSBYE medium, shake and culture at 35°C for 24 hours, take 200 μL of bacterial suspension, centrifuge at 5000 rpm for 2 minutes, and collect the bacteria for subsequent DNA extraction. According to the sequence information published by NCBI, the relatively conserved hemolysin coding gene hlyA of Listeria monocytogenes was used as the target sequence, and the partial sequence is as follows (GenBank NO.AB566375):

[0080] CAGATTTTTCGGCAAAGCTGTTACTAAAGAGCAGTTGCAAGCTTGGAGTGAATGCAGAAAATCCTCCTGCATATCTCCAAGTGT GGCATATGGCCGCCGTCCAAGTTTATTTGAAATTATCAACTAATTCCCATAGTACTAAAGTAAAAGCTGCTTTTGACGCTGCCGTAAGTGGGAAA TCTGTCTCAGGTGATGTAGAACTGACAAATATCAT (shown in SEQ ID NO. 1)

[0081] 1. According to the above sequences, design th...

Embodiment 2

[0109] Example 2: Bridge hairpin primer BHP-RCA detects single-stranded DNA

[0110] This implementation case uses porcine circovirus (Porcine Circovirus, PCV) inactivated vaccine as a sample. The vaccine was purchased from Harbin Veken Biotechnology Development Company, and the virus content of the vaccine was not less than 105.5 TCID50 before inactivation. PCV is a single-stranded closed circular DNA virus with a full-length genome of about 1.76 kb. PCV2 has high pathogenicity and is the main pathogen of post-weaning multisystemic wasting syndrome in piglets. According to the sequence information released by NCBI, the relatively conservative replication-related gene Rep of PCV2 is used as the target sequence, and the partial sequence is as follows (GenBank No. AF207700):

[0111] CTAGATCTCAAGGACAACGGAGTGACCTTGTCTACTGCTGTGAGTACCTTGTTGGAGAGCGGGAGTCTGGTGGCCGTTGCAGAGCAGC ACCCTGTAACGTTTGTCAGAAATTTCCGCGGGCTGGCTGAACTTTTGAAAGTGAGCGGGAAAATGCAGAAGCGTGATTGGAAGACGAATGT ACACGTCATTGTGGG...

Embodiment 3

[0135] Example 3: Bridge hairpin primer BHP-RCA detects RNA

[0136] In this embodiment, human immunodeficiency virus (Human Immunodeficiency Virus, HIV) is used as the detection object. Viral RNA samples were donated by Dr. Xu Feihai from Xiamen Wantai Canghai Biotechnology Co., Ltd. HIV is a single-stranded RNA retrovirus, and the vast majority of AIDS is caused by HIV-1. According to the sequence information published by NCBI, the gag gene, a relatively conserved structural protein of HIV-1, is used as the target sequence, and the partial sequence is as follows

[0137] (GenBank NO.: AF128998):

[0138] TCGACGGAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAATTTTTACTAGCGGAGGC TAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATAAATGGGAGAAAATTCGGTTAAGGCCAGGAGGAAAGQGAACATATCAGTAAAAACATAGTATGGGGTAGAGTAGTAAGNOAAACATAGTATGG

[0139] 1. According to the above sequence, design the required five primers, the primer sequence is as follows:

[0140] Outer prim...