Preparation method of PCV2 (Porcine Circovirus2)-D

A porcine circovirus and attenuated vaccine technology, applied in biochemical equipment and methods, antiviral agents, viruses/bacteriophages, etc., can solve the problems of weak and difficult viruses

Inactive Publication Date: 2013-09-04
SHANGHAI ACAD OF AGRI SCI
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional method of obtaining attenuated strain vaccine requires long-term passage, but the genome of circovirus is very conservative, and it is extremely difficult to weaken the virus through passage

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of PCV2 (Porcine Circovirus2)-D
  • Preparation method of PCV2 (Porcine Circovirus2)-D
  • Preparation method of PCV2 (Porcine Circovirus2)-D

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1 pET30a-PCV2 whole gene, the construction of exchange recombinant plasmid

[0042] 2.1 Extraction of PCV2 DNA: extract according to the conventional method of phenol chloroform.

[0043] 2.2 PCV2 whole gene sequence amplification

[0044] 2.2.1 Primer design and synthesis

[0045] Design a pair of primers with reference to the sequence on Genbank, marked as PCV-F / R, the specific sequence is as follows, the italics are the enzyme cutting sites, and the full length of the amplified fragment is expected to be 1767bp. Primers were synthesized by Shanghai Jierui Bioengineering Co., Ltd.

[0046] PCV-F: AGAATTCAACCTTAACCTTTCT

[0047] PCV-R: AGAATTCTGGCCCTGCTCC

[0048] 2.2.2 PCR amplification

[0049] PCR reaction system: 2 μL of DNA template extracted from disease materials, 10×Buffer (Mg 2+ free) 2.5 μL, MgSO 4 2 μL, 2 mmol / L dNTP 2.5 μL, 10 μmol / L PCV-F and R primers 1 μL each, KOD-Plus enzyme 1 μL, ddH 2 O 13 μL, total volume 25 μL; mix on ice.

[00...

Embodiment 2

[0077] The construction of embodiment 2PCV2 and PCV2-D strain

[0078] 2.6 Digestion of pET30a-PCV2 and pET30a-PCV2-D plasmids

[0079] Digest pET30a-PCV2 plasmid: 20 μL pET30a-PCV2 plasmid, 3 μL 10×buffer for EcoR I, 3 μL EcoR I, 4 μL ddH 2 O, the total reaction volume is 30 μL; 37 ° C water bath for 2 ~ 3 h.

[0080] Digestion of pET30a-PCV2-D plasmid: 20 μL of pET30a-PCV2-D plasmid, 3 μL of 10×buffer for EcoR I, 3 μL of EcoR I, 4 μL of ddH 2 O, the total reaction volume is 30 μL; 37 ° C water bath for 2 ~ 3 h.

[0081] Results: After the complete digestion was identified by 1% agarose gel electrophoresis, the whole PCV2 gene and PCV2-D gene fragments were recovered with a small DNA gel recovery kit. For enzyme digestion results, see image 3 , indicating that the size of the PCV2 gene fragment before and after transformation was consistent.

[0082] 2.7 Ligation circularization and recovery in vitro

[0083] The linear PCV2 full gene and PCV2-D gene fragments recovere...

Embodiment 3

[0087] Example 3 Transfection of PK-15 cells and the detection of replication and proliferation

[0088] 2.8 Cell transfection test

[0089] (1) Take out a bottle of pk15 cells in good growth state, transfer them to a 24-well plate, and inoculate about 1.25×10 cells per well 5 Put the cells in 500 μL DMEM complete medium without antibiotics at 37°C CO 2 cultured in an incubator. Make sure that the adherent cells in each well grow to 90%-95% before transfection.

[0090] (2) Circularized DNA and transfection reagent dilution

[0091] Put 0.6ug of the circularized PCV2 and PCV2-D plasmids obtained in step 2.7 into 50 μL DMEM without antibiotics and serum.

[0092] Take the transfection reagent Lipofectamine TM 2000 2.4 μL into 100 μL of MEM without antibiotics and serum, shake gently to mix, and incubate at room temperature for 5 minutes.

[0093] (3) Mix the diluted circularized DNA and transfection reagent in equal volumes of 50 μL each, and incubate at room temperature fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of PCV2 (Porcine Circovirus2)-D. The microorganism preservation number of PCV2 (Porcine Circovirus2) is CGMCC (China General Microbiological Culture Collection Center) No.7245. According to the preparation method, the preference of genetic codon of the PCV2 is modified, and the preferred codon is modified into non-preference codon, so that the expressions of the components of the virus are reduced, further, the copy rate of the virus in host cells is lowered, the virus is weakened, and the PCV2-D is obtained by genetic modification. Furthermore, the proliferation speed of the PCV2-D is compared with that of wild type strains at a cellular level. The detection of PCR (Polymerase Chain Reaction) and IFA (Indirect Immunofluorescence Assay) prove that the PCV2-D can be infected and copied in cells, and has certain infection.

Description

technical field [0001] The invention relates to a preparation method of a porcine circovirus attenuated vaccine strain. Background technique [0002] Porcine circovirus (Porcine circovirus, PCV) belongs to the family Circoviridae and the genus Circovirus, and is a single-stranded negative-sense circular DNA virus. The virus particles of this family have a diameter of 14-25nm, a 20-hedron symmetrical structure, and no envelope. It is one of the smallest animal viruses known. [0003] PCV can be divided into two serotypes, PCV 1 and PCV2. The PCV obtained from the PK-15 cell line has no pathogenicity and is designated as PCV type 1; while the pathogenic PCV is designated as PCV type 2. [0004] PCV2 is the main pathogen that causes Post weaning multisystemic wasting syndrome (PMWS) in weaned piglets. Clinically, the diseased pigs show progressive emaciation or growth retardation, dyspnea, inguinal lymphadenopathy, diarrhea, anemia and jaundice. It has also been associated ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/11C12N15/70A61K39/12A61P31/20
Inventor易建中刘成倩李红于宗幸
OwnerSHANGHAI ACAD OF AGRI SCI