Fusion receptor and gene medicine thereof for treating colorectal cancer
A gene drug and receptor gene technology, which is applied in the field of fusion receptors and their gene drugs for the treatment of colorectal cancer, can solve the problems that the specificity is not as good as TRAIL, and achieve the effect of specific induction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1. Construction of pAM-SVN-eDR4 / iFAS and pAM-CAG-sTRAIL vectors
[0043] 1. Acquisition of eDR4 / iFAS gene and vector construction
[0044] 1) Acquisition of eDR4 / iFAS gene
[0045] Searched and analyzed the gene sequence of the death receptor DR4 extracellular region eDR4 in GenBank, designed corresponding specific primers, and entrusted Shanghai Sangon Bioengineering Co., Ltd. to synthesize them together.
[0046] a) Acquisition of eDR4 gene: activate the pUC57-eDR4 / DH5α glycerol bacterium with eDR4 gene sequence, extract the plasmid pUC57-eDR4 according to the plasmid mini-extraction kit (Beyotime), and use specific primers with this plasmid as a template: Sense primer: CACGTGGGGATCCA CCATGGCGCCACCACCAGC; Antisense primer:
[0047] CTTCCTTTTCTCTTACCTGAGCCGATGCAACAACPCR was performed. The specific reaction system for PCR was 0.3 μL of Pyrobest DNA Polymerase (Takara), 5 μL of 10×Pyrobest Buffer II, 4 μL of dNTP Mixture (2.5 mM each), 0.2 μL of plasmid pUC57-...
Embodiment 2
[0066] Example 2. Effects of Recombinant Plasmids on Cell Survival and Apoptosis
[0067] 1. Massive extraction and purification of recombinant plasmids
[0068] Use the QIAGEN plasma Mega Kit reagents to extract and purify the recombinant plasmids pAM-CAG-eGFP, pAM-SVN-eDR4 / iFAS and pAM-CAG-sTRAIL, and measure the nucleic acid DNA of the above three recombinant plasmids using a UV spectrophotometer A 260 / A 280 The ratios are all within the normal range of 1.8-2.0.
[0069] 2. Determination of cell viability by MTT method
[0070] The cells used in this example are human embryonic kidney cell line HEK293 and human colorectal cancer cell line HT-29. in DMEM medium (GIBCO) (Sigma) at 37°C, 5% CO 2 Continuous culture was carried out under standard environmental conditions of saturated humidity. The day before transfection, the cells were treated with 10 4 Amount / well was seeded in a 96-well plate. Lipofectamine 2000 (Invitrogen) reagent was used to transiently transfect ...
Embodiment 3
[0083] Example 3, packaging, purification and activity verification of rAAV2
[0084] 1. Packaging of rAAV2
[0085] In the present invention, conventional calcium phosphate co-precipitation method is used to transfect HEK293 cells, and a three-plasmid system is used to package rAAV2. The packaged rAAV2 includes rAAV2.eGFP, rAAV2.sTRAIL and rAAV2.eDR4 / iFAS, and rAAV2.eGFP is used as a control group.
[0086] 2. Purification of rAAV2
[0087] Viruses were harvested 64 h after transfection. After the cells were collected, the cells were lysed by repeated freezing and thawing, the virus was purified by CsCl density gradient centrifugation, and dialyzed three times with PBS.
[0088] 3. Determination of cell viability by MTT method
[0089] 24 hours before virus infection, HT-29 cells were inoculated in 96-well cell culture plates, 10 4 cells / well. The purified rAAV2.eGFP, rAAV2.eDR4 / iFAS, and rAAV2.sTRAIL viruses were filtered through a 0.22 μm filter, and three parallel wel...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 