Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion receptor and gene medicine thereof for treating colorectal cancer

A gene drug and receptor gene technology, which is applied in the field of fusion receptors and their gene drugs for the treatment of colorectal cancer, can solve the problems that the specificity is not as good as TRAIL, and achieve the effect of specific induction

Inactive Publication Date: 2015-01-21
HUAQIAO UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the apoptosis-inducing effect of iFas is stronger than that of TRAIL, its specificity is far less than that of TRAIL

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion receptor and gene medicine thereof for treating colorectal cancer
  • Fusion receptor and gene medicine thereof for treating colorectal cancer
  • Fusion receptor and gene medicine thereof for treating colorectal cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1. Construction of pAM-SVN-eDR4 / iFAS and pAM-CAG-sTRAIL vectors

[0043] 1. Acquisition of eDR4 / iFAS gene and vector construction

[0044] 1) Acquisition of eDR4 / iFAS gene

[0045] Searched and analyzed the gene sequence of the death receptor DR4 extracellular region eDR4 in GenBank, designed corresponding specific primers, and entrusted Shanghai Sangon Bioengineering Co., Ltd. to synthesize them together.

[0046] a) Acquisition of eDR4 gene: activate the pUC57-eDR4 / DH5α glycerol bacterium with eDR4 gene sequence, extract the plasmid pUC57-eDR4 according to the plasmid mini-extraction kit (Beyotime), and use specific primers with this plasmid as a template: Sense primer: CACGTGGGGATCCA CCATGGCGCCACCACCAGC; Antisense primer:

[0047] CTTCCTTTTCTCTTACCTGAGCCGATGCAACAACPCR was performed. The specific reaction system for PCR was 0.3 μL of Pyrobest DNA Polymerase (Takara), 5 μL of 10×Pyrobest Buffer II, 4 μL of dNTP Mixture (2.5 mM each), 0.2 μL of plasmid pUC57-...

Embodiment 2

[0066] Example 2. Effects of Recombinant Plasmids on Cell Survival and Apoptosis

[0067] 1. Massive extraction and purification of recombinant plasmids

[0068] Use the QIAGEN plasma Mega Kit reagents to extract and purify the recombinant plasmids pAM-CAG-eGFP, pAM-SVN-eDR4 / iFAS and pAM-CAG-sTRAIL, and measure the nucleic acid DNA of the above three recombinant plasmids using a UV spectrophotometer A 260 / A 280 The ratios are all within the normal range of 1.8-2.0.

[0069] 2. Determination of cell viability by MTT method

[0070] The cells used in this example are human embryonic kidney cell line HEK293 and human colorectal cancer cell line HT-29. in DMEM medium (GIBCO) (Sigma) at 37°C, 5% CO 2 Continuous culture was carried out under standard environmental conditions of saturated humidity. The day before transfection, the cells were treated with 10 4 Amount / well was seeded in a 96-well plate. Lipofectamine 2000 (Invitrogen) reagent was used to transiently transfect ...

Embodiment 3

[0083] Example 3, packaging, purification and activity verification of rAAV2

[0084] 1. Packaging of rAAV2

[0085] In the present invention, conventional calcium phosphate co-precipitation method is used to transfect HEK293 cells, and a three-plasmid system is used to package rAAV2. The packaged rAAV2 includes rAAV2.eGFP, rAAV2.sTRAIL and rAAV2.eDR4 / iFAS, and rAAV2.eGFP is used as a control group.

[0086] 2. Purification of rAAV2

[0087] Viruses were harvested 64 h after transfection. After the cells were collected, the cells were lysed by repeated freezing and thawing, the virus was purified by CsCl density gradient centrifugation, and dialyzed three times with PBS.

[0088] 3. Determination of cell viability by MTT method

[0089] 24 hours before virus infection, HT-29 cells were inoculated in 96-well cell culture plates, 10 4 cells / well. The purified rAAV2.eGFP, rAAV2.eDR4 / iFAS, and rAAV2.sTRAIL viruses were filtered through a 0.22 μm filter, and three parallel wel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fusion receptor and a gene medicine thereof for treating colorectal cancer; the fusion receptor is formed by joining and fusing an eDR4 gene with an iFAS gene; the gene sequence of the fusion receptor is represented by SEQ ID NO.1; protein coded by the fusion receptor can be bonded to protein of a tumour related apoptosis inducing ligand TRAIL; the fusion acceptor gene and an sTRAIL gene are bonded to form the gene medicine capable of curing colorectal cancer; a use method of the gene medicine comprises the following steps of: driving sTRAIL gene expression by using a CAG constitutive promoter; driving fusion acceptor expression of the eDR4 gene and the iFAS gene by using a tumour specific Survivin promoter; carrying out signal transduction between the sTRAIL and iFAS fusion acceptor multiple target points through a DR acceptor and the eDR4 gene thereof; specifically inducing tumour cell apoptosis.

Description

【Technical field】 [0001] The invention relates to a fusion receptor and gene medicine for treating colorectal cancer. 【Background technique】 [0002] According to statistics from the International Agency for Research on Cancer, colorectal cancer is the third leading cause of cancer death worldwide, with more than 1 million new cases of colorectal cancer every year, and its incidence rate is second only to lung cancer and breast cancer. At present, the means of clinical treatment of colorectal cancer include surgery (applicable to early stage), chemotherapy, radiotherapy (with large side effects), etc., and the existing clinical drugs include paclitaxel and gemcitabine (the therapeutic effect of a single species is limited), etc. There is an urgent need for effective therapeutic drugs to solve the problem of clinical medication. Tumor gene therapy has gradually become the fourth major therapy for tumors after drug therapy, surgical therapy and radiotherapy. [0003] Emergin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62A61K48/00A61P35/00
Inventor 李招发邓小英惠二京刁勇许瑞安
Owner HUAQIAO UNIVERSITY