Unlock instant, AI-driven research and patent intelligence for your innovation.

BAT3 gene mutation detection specific primer and liquid phase chip

A detection solution and specific technology, applied in the field of molecular biology, can solve the problems of easy contamination of samples, detection limitations, and high false positive rate, and achieve the effects of avoiding uncertain factors, consistent detection results, and low cross-reaction rate.

Inactive Publication Date: 2013-12-18
SUREXAM BIO TECH
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the BAT3 gene mutation detection methods mainly include: Illumina fiber optic bead chip technology, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and fluorescent quantitative PCR technology, although Illumina fiber optic bead chip technology is highly sensitive and Accurate high-throughput detection system, but with low degree of automation and many manual operations, it is difficult to meet the needs of practical applications. Fluorescence quantitative PCR technology has the disadvantages of low sensitivity, easy contamination of samples, and high false positive rate. Matrix-assisted laser analysis and ionization Time-of-flight mass spectrometry is a soft ionization technology that has powerful and mature functions in the detection of protein and other biological macromolecules. However, in the field of nucleic acid detection, due to the particularity of nucleic acid molecules, the detection is subject to certain restrictions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • BAT3 gene mutation detection specific primer and liquid phase chip
  • BAT3 gene mutation detection specific primer and liquid phase chip
  • BAT3 gene mutation detection specific primer and liquid phase chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1B

[0033] Embodiment 1 BAT3 gene mutation detection liquid chip mainly includes:

[0034] 1. ASPE Primers

[0035] Specific primer sequences were designed for wild type and mutant type of two common genotypes of BAT3 gene, A131C and G96A. ASPE primers consist of "tag sequence + specific primer sequence". ASPE primer sequences are shown in the table below:

[0036] ASPE primer sequence (specific primer sequence) of table 1BAT3 gene

[0037]

[0038] Table 2 ASPE primer sequence (tag sequence) of BAT3 gene

[0039] SEQ ID

tag sequence (5'-3')

[0040] No.

5

TCATTTACCAATCTTTCTTTATAC

6

TCATTTCAATCAATCATCAACAAT

7

TATATACACTTCTCAATAACTAAC

8

AATTCTACAAATCCAATAATCTCAT

9

TCATTTACTCAAACAATTACAAATC

10

CTTTAATTCACACTTTCTAACAAT

[0041] Each ASPE primer includes two parts, the 5' end is the specific tag sequence for the anti-tag sequence on the corresponding microspher...

Embodiment 2B

[0053] Example 2 BAT3 gene mutation detection liquid chip detection of samples

[0054] The formula of described various solutions is as follows:

[0055] 50mM MES buffer (pH5.0) formula (250ml):

[0056]

[0057] 2×Tm hybridization buffer

[0058] Reagent

source

Final concentration

Dosage per 250ml

1M Tris-HCl, pH8.0

SigmaT3038

0.2M

50ml

5M NaCl

Sigma S5150

0.4M

20ml

Triton X-100

Sigma T8787

0.16%

0.4ml

[0059] Store at 4°C after filtration.

[0060] ExoSAP-IT kit was purchased from US USB Company.

[0061] Biotin-labeled dCTP was purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0062] 1. Sample DNA extraction:

[0063] Refer to the relevant methods of DNA extraction in "Molecular Cloning" to obtain the DNA to be detected.

[0064] 2. PCR amplification of samples to be tested

[0065] Design 2 pairs of primers and multiplex PCR to amplify 2 ...

Embodiment 3

[0110] The liquid phase chip of embodiment 3 different ASPE primers is to the detection of BAT3 gene SNP site

[0111] 1. Design of liquid phase chip preparation (selection of Tag sequence and Anti-Tag sequence)

[0112] Taking the BAT3 gene A131C and G96A site mutation detection liquid chip as an example, the specific primer sequence of the 3' end of the ASPE primer was designed for the wild type and mutant type of A131C and G96A, and the Tag sequence at the 5' end of the ASPE primer was selected from SEQ ID NO.5-SEQ ID NO.10, correspondingly, the anti-tag sequence coated on the microsphere and complementary to the corresponding tag sequence is selected from SEQ ID NO.11-SEQ ID NO.16. The specific design is shown in the following table (Table 9). The synthesis of ASPE primers, microspheres coated with anti-tag sequences, amplification primers, detection methods, etc. are as described in Example 1 and Example 2.

[0113] Table 9 Design of liquid phase chip preparation

[01...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a BAT3 gene mutation detection liquid phase chip and a specific primer. The liquid phase chip mainly comprises: an ASPE primer composed of a tag sequence at 5'-terminal and specific primer sequences against the mutation site of a target gene at 3'-terminal, wherein the specific primer sequences comprise SEQ ID NO.1 and SEQ ID NO.2 against an A131C site, and / or SEQ ID NO.3 and SEQ ID NO.4 against a G96A site; a microsphere coated with an anti-tag sequence; and an amplimer. The coincidence rate between the detection result of the detection liquid phase chip and a sequencing method is 100%, and the wild and mutant parallel detection of a plurality of mutation sites can be realized.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, in particular to a BAT3 gene mutation detection specific primer and a liquid phase chip. Background technique [0002] The full name of BAT3 is HLA-B associated transcript 3 (HLA-B associated transcript 3, BAT3), also known as Scythe or BAG6, located on chromosome 6 6p21.33, located in human major histocompatibility complex Ⅲ (major histocompatibility complex Ⅲ, MHC Ⅲ) area. The BAT3 gene encodes a nuclear protein, which is related to the regulation of apoptosis and the function of heat shock proteins. In addition, the BAT3 gene is associated with the occurrence of lung cancer. [0003] At present, the BAT3 gene mutation detection methods mainly include: Illumina fiber optic bead chip technology, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and fluorescent quantitative PCR technology, although Illumina fiber o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 许嘉森吴诗扬
Owner SUREXAM BIO TECH