BAT3 gene mutation detection specific primer and liquid phase chip
A detection solution and specific technology, applied in the field of molecular biology, can solve the problems of easy contamination of samples, detection limitations, and high false positive rate, and achieve the effects of avoiding uncertain factors, consistent detection results, and low cross-reaction rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1B
[0033] Embodiment 1 BAT3 gene mutation detection liquid chip mainly includes:
[0034] 1. ASPE Primers
[0035] Specific primer sequences were designed for wild type and mutant type of two common genotypes of BAT3 gene, A131C and G96A. ASPE primers consist of "tag sequence + specific primer sequence". ASPE primer sequences are shown in the table below:
[0036] ASPE primer sequence (specific primer sequence) of table 1BAT3 gene
[0037]
[0038] Table 2 ASPE primer sequence (tag sequence) of BAT3 gene
[0039] SEQ ID
tag sequence (5'-3')
[0040] No.
5
TCATTTACCAATCTTTCTTTATAC
6
TCATTTCAATCAATCATCAACAAT
7
TATATACACTTCTCAATAACTAAC
8
AATTCTACAAATCCAATAATCTCAT
9
TCATTTACTCAAACAATTACAAATC
10
CTTTAATTCACACTTTCTAACAAT
[0041] Each ASPE primer includes two parts, the 5' end is the specific tag sequence for the anti-tag sequence on the corresponding microspher...
Embodiment 2B
[0053] Example 2 BAT3 gene mutation detection liquid chip detection of samples
[0054] The formula of described various solutions is as follows:
[0055] 50mM MES buffer (pH5.0) formula (250ml):
[0056]
[0057] 2×Tm hybridization buffer
[0058] Reagent
source
Final concentration
Dosage per 250ml
1M Tris-HCl, pH8.0
SigmaT3038
0.2M
50ml
5M NaCl
Sigma S5150
0.4M
20ml
Triton X-100
Sigma T8787
0.16%
0.4ml
[0059] Store at 4°C after filtration.
[0060] ExoSAP-IT kit was purchased from US USB Company.
[0061] Biotin-labeled dCTP was purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0062] 1. Sample DNA extraction:
[0063] Refer to the relevant methods of DNA extraction in "Molecular Cloning" to obtain the DNA to be detected.
[0064] 2. PCR amplification of samples to be tested
[0065] Design 2 pairs of primers and multiplex PCR to amplify 2 ...
Embodiment 3
[0110] The liquid phase chip of embodiment 3 different ASPE primers is to the detection of BAT3 gene SNP site
[0111] 1. Design of liquid phase chip preparation (selection of Tag sequence and Anti-Tag sequence)
[0112] Taking the BAT3 gene A131C and G96A site mutation detection liquid chip as an example, the specific primer sequence of the 3' end of the ASPE primer was designed for the wild type and mutant type of A131C and G96A, and the Tag sequence at the 5' end of the ASPE primer was selected from SEQ ID NO.5-SEQ ID NO.10, correspondingly, the anti-tag sequence coated on the microsphere and complementary to the corresponding tag sequence is selected from SEQ ID NO.11-SEQ ID NO.16. The specific design is shown in the following table (Table 9). The synthesis of ASPE primers, microspheres coated with anti-tag sequences, amplification primers, detection methods, etc. are as described in Example 1 and Example 2.
[0113] Table 9 Design of liquid phase chip preparation
[01...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
