Protein for diagnosis and prevention of tuberculosis
A protein and Mycobacterium tuberculosis technology, applied in the fields of biology, medical technology, and immunology, can solve problems such as long cycle, complicated operation, and application limitations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1: Amplification of Mycobacterium tuberculosis genes and expression of proteins
[0055] 1. Experimental method
[0056] 1.1 Acquisition of target gene
[0057] 1.1.1 According to the open reading frame (ORFs) gene sequence of Mycobacterium tuberculosis (MTB) H37Rv, use Primer designer to design primer sequences, according to the primer design scheme of Gateway system, add attB arm to the primer sequence, by Beijing Xinqingke Company Synthesis of primers is completed.
[0058] where the forward attB primer arm is:
[0059] GGGGACAAGTTTGTACAAAAAAGCAGGCTTC (SEQ ID NO: 41);
[0060] The reverse attB primer arm is:
[0061] GGGGACCACTTTGTACAAGAAAGCTGGGTCCTA (SEQ ID NO: 42),
[0062] The primer design was completed, as shown in Table 1.
[0063] 1.1.2 Acquisition of gene sequences
[0064] The genomic DNA of H37Rv (ATCC27294, from Beijing Tuberculosis Prevention and Control Institute) was extracted, and the H37Rv genome was used as a template to amplify differ...
Embodiment 2
[0126] Example 2 Purification of expressed protein
[0127] Protein purification is a must for downstream experiments, and prokaryotic cells can contain thousands of different proteins, some in abundance and some with only a few copies. In order to study a certain protein, the protein must first be purified from other proteins and non-protein molecules to remove false positives caused by exogenous impurities. To achieve high-efficiency and high-purity proteins, high-throughput protein purification is required. . The expression protein of the present invention is a prokaryotic expression containing a 6His tag, so the affinity of the adjacent histidine of the His.Tag sequence and the immobilized metal nickel ion is used for purification. The purification kit was 96-well plates His MultiTrap FF (GE healthcare, USA).
[0128] 2.1 Strain resurrection and amplification
[0129] Prepare the LB medium required for strain recovery and expansion, and add corresponding antibiotics after...
Embodiment 3
[0152] Embodiment 3west blot analysis
[0153] Western Blot technology is a protein immobilization and analysis technique, which is to transfer the protein separated by polyacrylamide gel or other gel or electrophoresis to the nitrocellulose filter membrane, and the protein component fixed on the filter membrane still retains the antigen Activity and the ability to specifically bind to other macromolecules, so it can bind to specific antibodies or nucleic acids. After the first antibody binds to the specific antigen on the membrane, it is detected by a labeled secondary antibody (isotope or non-isotope enzyme). This method can detect 1ng antigen protein.
[0154] The patient sample came from the Shenzhen Third People's Hospital. It was a newly diagnosed patient with tuberculosis. The enzyme-linked immunospot test (ELIAPOT) was positive. 200 tuberculosis patient serum samples were mixed and used in the primary screening reaction after removing E. coli antibodies. Western blot ...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap