Supercharge Your Innovation With Domain-Expert AI Agents!

Protein for diagnosis and prevention of tuberculosis

A protein and Mycobacterium tuberculosis technology, applied in the fields of biology, medical technology, and immunology, can solve problems such as long cycle, complicated operation, and application limitations

Inactive Publication Date: 2014-12-17
INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although it is the "golden indicator" for diagnosing pulmonary tuberculosis, its diagnostic rate is low and the culture period is long
2 Sputum tuberculosis culture, the results are highly reliable, and tuberculosis drug susceptibility test can be done, but it takes 6-8 weeks, and the application is limited
High false positive rate, easy to misdiagnose
2. Positive tuberculosis antibody detection in blood and sputum is also helpful for diagnosis, such as 38kDa and many fusion protein antigens including 38kDa antigen, which are used for the diagnosis of humoral immunity, but the false positive rate is also inevitable
[0011] (4) Other examinations can only be used as an auxiliary diagnosis and cannot be used as a basis for diagnosis
[0012] In the commonly used diagnostic techniques for pulmonary tuberculosis, there are problems such as low positive rate, long cycle, complicated operation, and high false positive rate. Therefore, there is an urgent need for a fast, simple, sensitive, and specific diagnostic method to quickly and accurately diagnose tuberculosis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein for diagnosis and prevention of tuberculosis
  • Protein for diagnosis and prevention of tuberculosis
  • Protein for diagnosis and prevention of tuberculosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: Amplification of Mycobacterium tuberculosis genes and expression of proteins

[0055] 1. Experimental method

[0056] 1.1 Acquisition of target gene

[0057] 1.1.1 According to the open reading frame (ORFs) gene sequence of Mycobacterium tuberculosis (MTB) H37Rv, use Primer designer to design primer sequences, according to the primer design scheme of Gateway system, add attB arm to the primer sequence, by Beijing Xinqingke Company Synthesis of primers is completed.

[0058] where the forward attB primer arm is:

[0059] GGGGACAAGTTTGTACAAAAAAGCAGGCTTC (SEQ ID NO: 41);

[0060] The reverse attB primer arm is:

[0061] GGGGACCACTTTGTACAAGAAAGCTGGGTCCTA (SEQ ID NO: 42),

[0062] The primer design was completed, as shown in Table 1.

[0063] 1.1.2 Acquisition of gene sequences

[0064] The genomic DNA of H37Rv (ATCC27294, from Beijing Tuberculosis Prevention and Control Institute) was extracted, and the H37Rv genome was used as a template to amplify differ...

Embodiment 2

[0126] Example 2 Purification of expressed protein

[0127] Protein purification is a must for downstream experiments, and prokaryotic cells can contain thousands of different proteins, some in abundance and some with only a few copies. In order to study a certain protein, the protein must first be purified from other proteins and non-protein molecules to remove false positives caused by exogenous impurities. To achieve high-efficiency and high-purity proteins, high-throughput protein purification is required. . The expression protein of the present invention is a prokaryotic expression containing a 6His tag, so the affinity of the adjacent histidine of the His.Tag sequence and the immobilized metal nickel ion is used for purification. The purification kit was 96-well plates His MultiTrap FF (GE healthcare, USA).

[0128] 2.1 Strain resurrection and amplification

[0129] Prepare the LB medium required for strain recovery and expansion, and add corresponding antibiotics after...

Embodiment 3

[0152] Embodiment 3west blot analysis

[0153] Western Blot technology is a protein immobilization and analysis technique, which is to transfer the protein separated by polyacrylamide gel or other gel or electrophoresis to the nitrocellulose filter membrane, and the protein component fixed on the filter membrane still retains the antigen Activity and the ability to specifically bind to other macromolecules, so it can bind to specific antibodies or nucleic acids. After the first antibody binds to the specific antigen on the membrane, it is detected by a labeled secondary antibody (isotope or non-isotope enzyme). This method can detect 1ng antigen protein.

[0154] The patient sample came from the Shenzhen Third People's Hospital. It was a newly diagnosed patient with tuberculosis. The enzyme-linked immunospot test (ELIAPOT) was positive. 200 tuberculosis patient serum samples were mixed and used in the primary screening reaction after removing E. coli antibodies. Western blot ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a protein for diagnosis and prevention of tuberculosis, a kit containing the protein and an application of the protein in preparation of the kit or preparation of a medicine for preventing and curing tuberculosis. Specifically, 21 proteins with good immunogenicity are screened from whole genome of mycobacterium tuberculosis. The proteins can be used for detecting mycobacterium tuberculosis infection or diagnosing tuberculosis and have good sensitivity and specificity. Or the proteins are used for preparing a vaccine so as to prevent or curing tuberculosis.

Description

technical field [0001] The invention belongs to the fields of medical technology, biology and immunology, and relates to a protein used for tuberculosis diagnosis and prevention, an antibody specifically binding to the protein, and a composition or kit containing the protein or antibody, the protein Or the use of the antibody in the preparation of a tuberculosis diagnostic kit and in the preparation of a drug for preventing or treating tuberculosis. Background technique [0002] Mycobacterium tuberculosis is one of the pathogens that pose the greatest threat to human health. Tuberculosis is a major infectious disease among adults in the world today, which has posed a serious challenge to international public health ([1] Khasnobis S., Escuyer V.E., Chatterjee D. Emerging therapeutic targets in tuberculosis: post-genomic era. Exper Opin. Ther. Targets, 2002, 6:21-40). According to the WHO report, there are about 2 billion people infected with tuberculosis in the world. There ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/195C12N15/31C12N15/63C12N5/10C07K16/12G01N33/68C12Q1/04A61K38/16A61K39/04A61P31/06
Inventor 刘立国金奇张笑冰张维佳
Owner INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More