Application of dihydrofolate synthetase and derivative thereof as well as preparation method and detection method of dihydrofolate synthetase

A technology of dihydrofolate and synthase, which is applied in the biological field to achieve the effect of a rapid detection method and a wide range of sources

Inactive Publication Date: 2014-12-17
NBGEN
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Bacteria are more likely to develop resistance to sulfa drugs, especially if the dose or duration of treatment is insufficient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of dihydrofolate synthetase and derivative thereof as well as preparation method and detection method of dihydrofolate synthetase
  • Application of dihydrofolate synthetase and derivative thereof as well as preparation method and detection method of dihydrofolate synthetase
  • Application of dihydrofolate synthetase and derivative thereof as well as preparation method and detection method of dihydrofolate synthetase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1: Cloning, expression and purification of dihydrofolate synthase

[0064] The primers were designed according to the corresponding gene sequence of EDV67101 published by Genebank. The upstream primer P1 (5'CGCGGATCC ATGAAACTCTTTGC3') and the downstream primer P2 (5'AACTGCAGTTACTCATAGCGTTTG3') contained restriction sites for BamH1 and PstI, respectively. Isolate Escherichia coli F11 from Escherichia coli isolated from chickens with colibacillosis. After culturing, pick a single colony and inoculate it in LB culture medium. Cultivate it until the OD600nm is about 0.4. Take 50 μl of the bacteria solution and centrifuge at a high speed (10000r / min, 1min) , discard the supernatant, add 100 μl PBS to suspend, then centrifuge and suspend again, add 100 μl double distilled water after repeating 3 times, centrifuge and suspend again with double distilled water, then perform PCR to amplify the target gene, and SDS electrophoresis to detect the product.

[0065] Use the D...

Embodiment 3

[0074] Example 3: Using HRP-labeled dihydrofolate synthase to detect sulfonamides in water

[0075] Coupling p-aminobenzenesulfonamide (V900101, sigma) with ovalbumin OVA by the diazotization method to obtain the original coating SAS-OVA, which was diluted to a concentration of 1 μg / mL with pH 9.6 carbonate buffer as Coating solution was used to coat the microtiter plate with 100 μl per well, and incubated overnight at 4°C. After completion, shake off the liquid, wash the plate with PBS-T, pat dry, add 100 μl of blocking solution (1% skimmed milk powder), incubate at 37°C for 2 hours, shake off the liquid and pat dry for later use.

[0076] The concentration of sulfonamide standard preparation is 0μg / L, 1μg / L, 3μg / L, 9μg / L, 27μg / L and 81μg / L.

[0077] Follow the steps below to measure:

[0078] (1) Add standard: Add 50 μl of sulfonamide standard to the coated microtiter plate, and dilute HRP-labeled recombinant dihydrofolate synthase protein to 1 μg / well with 0.1M PBS at pH ...

Embodiment 4

[0082] Example 4: Detection of sulfonamides in milk using colloidal gold-labeled dihydrofolate synthase

[0083] 1. Colloidal gold-labeled dihydrofolate synthase

[0084] The citric acid reduction method is used to prepare a nano-gold particle solution in the range of 20-40 nm, and the pH value is adjusted to 8.0 for later use. Take a certain amount of nano-gold particle solution, place it on a magnetic stirrer, then dilute the purified dihydrofolate synthase with PBS at a ratio of 1:2000, add it to the nano-gold solution and stir for 20-30 minutes, and then put The PEG10000 solution was added to the mixed reaction liquid so that the final concentration of PEG was about 1%, placed in a refrigerated centrifuge (4° C.) and centrifuged at a slow speed (1500-2500 rpm) for 20 minutes, then discarded the supernatant. The lower precipitate was repeatedly washed with PBS and centrifuged to discard excess supernatant. Finally, the precipitate was resuspended in PBS buffer to make the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention aims at providing an application of dihydrofolate synthetase in detection of sulphonamide residue and a rapid sulphonamide detection method constructed by utilizing the dihydrofolate synthetase. The dihydrofolate synthetase capable of detecting the sulphonamide residue is an amino acid sequence shown in a sequence SEQ ID NO.1. Compared with the traditional detection method, the dihydrofolate synthetase has the advantages that firstly the dihydrofolate synthetase is wide in source, protein fragments just containing a dihydrofolate synthetase core sequence can be applied, and the dihydrofolate synthetase can be rapidly and stably obtained by adopting a genetic engineering method; and secondly, a rapid detection method for all the sulphonamides containing a p-aminobenzene sulphonamide parent core structure can be constructed by utilizing the new application of the dihydrofolate synthetase.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a new application of dihydrofolate synthase in drug residue detection. Background technique [0002] Dihydrofolate synthase (DHPS) is an essential catalytic enzyme for bacteria to synthesize dihydrofolate, and plays an important role in bacterial growth and reproduction. Usually bacterial growth needs to utilize p-aminobenzoic acid (PABA) and dihydropteridine and glutamic acid in the environment to synthesize dihydrofolate under the catalysis of dihydrofolate synthase in the bacteria. If there are structural analogs to PABA in the environment, it will inevitably inhibit the synthesis of dihydrofolate. [0003] Sulfonamides are a large class of artificially synthesized antibacterial drugs that have been used clinically for nearly 50 years. They have the advantages of wide antibacterial spectrum, stable properties, easy use, and no food consumption during production. The common structur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/70G01N33/531G01N33/532G01N33/535
CPCC12N9/93C12Y603/02012G01N33/573G01N33/577
Inventor杨春江刘勇朱文壮孟赓秦堃莫勋马孝斌
OwnerNBGEN