A kind of high oxalic acid-producing fungal recombinant strain and its construction method
A technology for recombining strains and fungi, applied in the biological field, can solve problems such as oxalate-deficient strains, and achieve the effects of expanding application and improving production yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1: BbGEL1 gene sequence analysis and cloning.
[0038] Refer to BbGEL1 in the genome of Beauveria bassiana 2860 (from the US Department of Agriculture ARSEF biocontrol fungal strain bank).
[0039] The sequence of the BbGEL1 gene is:
[0040]ATGCCTCCTCATGAAGGTCTCGTACACCTCAAGGAATACGACATCAAAGACAGCAATATCGAGCTGATTGGAACCGATATTGACCATCAGGTCAAATACAAGTCGGCAGCCGAGGAGCCCGCTTGGCACGTTGTCGGAAAGAGGCCAGGCCTGCTAATTTGGCGTATCGATAGCTTCCAGGTTGTTCCATGGCCTGAAGAGAAACATGGCCAATTCTACGATGGCGACAGCTTCATCGTCCTCCACTCCTTTAAAGTTGGCAGCAAGGATGGCTCCGAGAAGCTAGCCCACGCAATCTACTTTTGGCTCGGCAGCCACACGTCGCAGGACGAGGCTGGTACCGCCGCTTACAAAACTGTCGAGCTAGATGAGTTCCTTCACGGCGCCGCATCGCAACACCGAGAGGTGCAATCAGCCCCTTCTGATGAATTTCTCGCCTTGTTCCCCAAGATTTCCATTCGCTCCGGCGGTGTCCGATCCGGATTTAGACACGTCGAGGAGGCGCGCAAGGAGGATGTCACCACTCTCCTGCGCGTCTTCACCAACCCCGGGTCCAAAGCCTCCAACGGCGTGGTTGTCCACGAGGTTGAACCCACCTACCACAGCCTCGACGACGGTGACGTTTTCATCCTTGATAAAGGCGACAAGATCTGGGTCTGGCAGGGCAAGAGCTGCAGTCCCATGGAAAAGGCCAAGGCTGCCCAAATCGTGCACGACATGACTCTCGCAAAGCAC...
Embodiment 2
[0041] Example 2: Construction of gene BbGEL1 knockout strain.
[0042] Construction of gene knockout modules by gene fusion technology.
[0043] Using the Beauveria bassiana genome in Example 1 as a template, amplification primers were designed, and the upstream and downstream fragments of the gene knockout module were respectively amplified by PCR reactions. PCR reaction system: 2 μL fungal cDNA, 1 μL primer, 2 μL dNTP, 5 μL MgCl2, 5 μL LA Taq polymerase buffer and 0.5 μL LA Taq polymerase. PCR cycle conditions: pre-denaturation at 94°C for 5 min, 35 cycles (denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 2 min), and extension at 72°C for 7 min after the cycle was completed.
[0044] Then, by PCR fusion technology, the upstream and downstream fragments were respectively fused to the upstream and downstream of the expression element of the Beauveria bassiana screening marker glufosinate resistance gene Bar to construct a gene replacement ...
Embodiment 3
[0058] Example 3: Fermentation of high-yield strains to produce acid.
[0059] The conidia of the original strain and the fungal recombinant strain obtained in Example 2 were respectively inoculated in the fermentation medium, and cultured at 25° C. for 3 days. After the culture solution was filtered and centrifuged several times, a clear solution was obtained. After the culture solution of the wild strain was diluted 10 times and the culture solution of the mutant strain was diluted 20 times, the content of oxalic acid was determined by ion chromatography.
[0060] Determination conditions of ion chromatography: Turn on the ion chromatography instrument (ICS 2000), turn on the gas source switch, adjust the pressure reducing gauge to 0.1-0.2 psi; adjust the pressure reducing valve behind the eluent organizer to between 6-9 psi between. Open the PRIME valve on the balanced pump head to exhaust at a flow rate of 3 mL / min for 5 min. The eluent was 30 mM potassium hydroxide. T...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com