A kind of high oxalic acid-producing fungal recombinant strain and its construction method

A technology for recombining strains and fungi, applied in the biological field, can solve problems such as oxalate-deficient strains, and achieve the effects of expanding application and improving production yield

Active Publication Date: 2017-04-05
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the trace amount of oxalic acid in the common microbial cells is an intermediate product of the metabolic pathway, which cannot or can only secrete a trace amount of oxalic acid into the medium, which makes the use of microbial fermentation to produce oxalic acid lack of suitable strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of high oxalic acid-producing fungal recombinant strain and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: BbGEL1 gene sequence analysis and cloning.

[0038] Refer to BbGEL1 in the genome of Beauveria bassiana 2860 (from the US Department of Agriculture ARSEF biocontrol fungal strain bank).

[0039] The sequence of the BbGEL1 gene is:

[0040]ATGCCTCCTCATGAAGGTCTCGTACACCTCAAGGAATACGACATCAAAGACAGCAATATCGAGCTGATTGGAACCGATATTGACCATCAGGTCAAATACAAGTCGGCAGCCGAGGAGCCCGCTTGGCACGTTGTCGGAAAGAGGCCAGGCCTGCTAATTTGGCGTATCGATAGCTTCCAGGTTGTTCCATGGCCTGAAGAGAAACATGGCCAATTCTACGATGGCGACAGCTTCATCGTCCTCCACTCCTTTAAAGTTGGCAGCAAGGATGGCTCCGAGAAGCTAGCCCACGCAATCTACTTTTGGCTCGGCAGCCACACGTCGCAGGACGAGGCTGGTACCGCCGCTTACAAAACTGTCGAGCTAGATGAGTTCCTTCACGGCGCCGCATCGCAACACCGAGAGGTGCAATCAGCCCCTTCTGATGAATTTCTCGCCTTGTTCCCCAAGATTTCCATTCGCTCCGGCGGTGTCCGATCCGGATTTAGACACGTCGAGGAGGCGCGCAAGGAGGATGTCACCACTCTCCTGCGCGTCTTCACCAACCCCGGGTCCAAAGCCTCCAACGGCGTGGTTGTCCACGAGGTTGAACCCACCTACCACAGCCTCGACGACGGTGACGTTTTCATCCTTGATAAAGGCGACAAGATCTGGGTCTGGCAGGGCAAGAGCTGCAGTCCCATGGAAAAGGCCAAGGCTGCCCAAATCGTGCACGACATGACTCTCGCAAAGCAC...

Embodiment 2

[0041] Example 2: Construction of gene BbGEL1 knockout strain.

[0042] Construction of gene knockout modules by gene fusion technology.

[0043] Using the Beauveria bassiana genome in Example 1 as a template, amplification primers were designed, and the upstream and downstream fragments of the gene knockout module were respectively amplified by PCR reactions. PCR reaction system: 2 μL fungal cDNA, 1 μL primer, 2 μL dNTP, 5 μL MgCl2, 5 μL LA Taq polymerase buffer and 0.5 μL LA Taq polymerase. PCR cycle conditions: pre-denaturation at 94°C for 5 min, 35 cycles (denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 2 min), and extension at 72°C for 7 min after the cycle was completed.

[0044] Then, by PCR fusion technology, the upstream and downstream fragments were respectively fused to the upstream and downstream of the expression element of the Beauveria bassiana screening marker glufosinate resistance gene Bar to construct a gene replacement ...

Embodiment 3

[0058] Example 3: Fermentation of high-yield strains to produce acid.

[0059] The conidia of the original strain and the fungal recombinant strain obtained in Example 2 were respectively inoculated in the fermentation medium, and cultured at 25° C. for 3 days. After the culture solution was filtered and centrifuged several times, a clear solution was obtained. After the culture solution of the wild strain was diluted 10 times and the culture solution of the mutant strain was diluted 20 times, the content of oxalic acid was determined by ion chromatography.

[0060] Determination conditions of ion chromatography: Turn on the ion chromatography instrument (ICS 2000), turn on the gas source switch, adjust the pressure reducing gauge to 0.1-0.2 psi; adjust the pressure reducing valve behind the eluent organizer to between 6-9 psi between. Open the PRIME valve on the balanced pump head to exhaust at a flow rate of 3 mL / min for 5 min. The eluent was 30 mM potassium hydroxide. T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fungal recombinant strain of high-yield oxalic acid. The fungal recombinant strain has a preservation number of CGMCC NO.9451 and a latin name as Beauveriabassiana, wherein the fungal recombinant strain is beauveria bassiana. The invention further provides a construction method of the fungal recombinant strain. The construction method comprises the following steps: utilizing entomopathogenic fungus beauveria bassiana as a research material, utilizing a gene knockout technology to damage a fungal Gelsolin gene to obtain an oxalic acid high-yield strain. The recombinant strain construction idea and the recombinant strain adopted in the invention provide relatively efficient and environment-friendly technical method for improving oxalic acid production.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to DNA recombination technology and application in the field of bioengineering technology, in particular to a fungal recombinant strain with high oxalic acid production and a construction method thereof. Background technique [0002] Oxalic acid, also known as oxalic acid, is one of the simplest organic dibasic acids. Oxalic acid is a necessary reagent for the intermediates of synthetic chemicals, mainly used in the preparation of fine chemical products such as various dyes, extractants and intermediates. In addition, oxalic acid is also a solvent for refining rare metals, a dye reducing agent, and a raw material for the production of antibiotics and borneol, and has a wide market demand. [0003] From the analysis of oxalic acid demand, 33% is used in the pharmaceutical industry; 25% is used in the rare earth industry; 35% is used in the metal processing and aluminum industry; and the r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/15C12N15/80C12P7/46C12R1/645
CPCC07K14/37C12P7/46
Inventor应盛华何普红冯明光
OwnerZHEJIANG UNIV