Specific grape powdery mildew resistant gene VpR8H-1 cDNA (complementary deoxyribonucleic acid) sequence and application of cDNA sequence
A powdery mildew resistance gene and grape technology, applied in the field of genetic engineering, can solve problems such as unreported research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1: Grape VpR8H-1 Gene Cloning and Sequence Analysis
[0023] a. Total RNA extraction and purification
[0024] Add 800 μl of SDS extraction buffer to a 2ml centrifuge tube, add a final concentration of 3% β-mercaptoethanol, mix thoroughly, take 100 mg of Baihe-35-1 grape leaves, put them in a liquid nitrogen precooled mortar, Grind thoroughly in nitrogen without lumps and quickly transfer to a centrifuge tube with extraction buffer, vortex to mix, ice bath for 20min, extract with chloroform:isoamyl alcohol at 24:1, add 1 / 3 volume of 8M LiCl to precipitate For RNA, wash the pellet twice with 75% ethanol, dry at room temperature for 10 min, add 30 μl DEPC-H 2 Dissolve in O, measure the OD value after electrophoresis detection, purify, take 2 μl RNA for 1.0% agarose gel electrophoresis to test the purity, take 1 μl to check the RNA concentration and freeze it at -80°C for later use;
[0025] b. cDNA synthesis
[0026] Using the extracted and purified total RNA a...
Embodiment 2
[0031] Example 2: Response of Tobacco Transient Expression VpR8H-1 Gene to Powdery Mildew
[0032] a. VpR8H-1 gene cloning
[0033] Extract the leaf RNA of the Chinese wild grape Baihe-35-1 strain, reverse-transcribe it into cDNA, and use the cDNA as a template to amplify the target gene by PCR. The upstream and downstream primers respectively introduce BamH Ⅰ restriction site, and the upstream primer : 5'AAGGATCCATGCGAATACAGGTTCATTATGTC3', downstream primer: 5'GGGGATCCACGCGGACTTCAAGATGATAGTTTC3', PCR reaction system: 1 μl of DNA template, high-fidelity LA enzyme, 1 μl of upstream and downstream primers, the reaction program is: 94°C for 2min, 94°C for 30S, 50°C for 30S, 3 min at 72°C, 30 cycles, 10 min at 72°C, 10 min at 4°C, and electrophoresis of the PCR product on a 1% agarose gel;
[0034] b. Plant expression vector construction
[0035] b.1 Recovery of target gene DNA fragments,
[0036] The DNA fragment of the target gene was recovered from the agarose gel with the D...
Embodiment 3
[0052] Example 3: The response of Arabidopsis stably expressing the VpR8H-1 gene to powdery mildew
[0053] a. VpR8H-1 gene cloning
[0054] The leaf RNA of the Chinese wild grape Baihe-35-1 strain was extracted, reverse-transcribed into cDNA, and the cDNA was used as a template to amplify the target gene by PCR, and a BamH Ⅰ restriction site was introduced into the upstream and downstream primers; the reaction procedure For: 94°C for 2 minutes, 94°C for 30S, 50°C for 30S, 72°C for 3min, 30 cycles, 72°C for 10min, 4°C for 10min, the PCR product was subjected to 1% agarose gel electrophoresis;
[0055] b. Plant expression vector construction
[0056] b.1 Recovery of target gene DNA fragments
[0057] The DNA fragment of the target gene was recovered from the agarose gel with the DNA recovery kit of Tiangen Biochemical Technology Co., Ltd., and the operation was carried out according to the kit instructions;
[0058] b.2 Ligation reaction between recovered fragment and clonin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
