Supercharge Your Innovation With Domain-Expert AI Agents!

Kit for detecting goldfish haematopoietic necrosis virus and application thereof

A hematopoietic organ necrosis and kit technology, applied in the field of molecular biology, can solve the problems of false negative test results, ethidium bromide contamination, nucleic acid contamination, etc., and achieve the effects of improving the positive rate, good repeatability and strong specificity

Inactive Publication Date: 2015-04-29
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The detection limit of the currently reported PCR detection method for GFHNV is lower than that of the fluorescent quantitative PCR detection method and the LAMP detection method, and the amplification product needs to be subjected to gel electrophoresis to observe the results, which is likely to cause ethidium bromide contamination; the LAMP detection method If the reaction time is too long, it is easy to produce false positives, and due to too many products, it is also easy to cause nucleic acid contamination; some fluorescent quantitative PCR detection methods reported so far are unstable, and the detection results sometimes produce false negatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting goldfish haematopoietic necrosis virus and application thereof
  • Kit for detecting goldfish haematopoietic necrosis virus and application thereof
  • Kit for detecting goldfish haematopoietic necrosis virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The design of embodiment 1 goldfish hematopoietic organ necrosis virus specific primer and probe

[0039] Comparing the DNA sequences of known specific genes of goldfish hematopoietic necrosis virus, screening out the specific sequence of goldfish hematopoietic necrosis virus gene, which is a conserved sequence (2307-2464) in the main capsid protein (MCP) gene of GFHNV , the nucleotide sequence of which is shown in SEQ ID NO.1. When designing primers and probes, care should be taken to avoid mutation points in the sequence. After repeated screening and verification, a pair of fluorescent quantitative PCR primers and probes used in conjunction with the primers were obtained for the detection of goldfish hematopoietic organ necrosis virus.

[0040] Upstream primer: CAAACCCAGCACCGTCAGATGGT (SEQ ID NO.2)

[0041] Downstream primer: ATCCGGCACAGGTGGCGTGT (SEQ ID NO. 3).

[0042] The fluorescent probe sequence is:

[0043] 5'-FAM-TTGGATCTGCTGCGCCCTGTTTGACAG-TAMRAN (SEQ ID N...

Embodiment 2

[0044] Example 2 Establishment of a fluorescent quantitative PCR detection method for detecting goldfish hematopoietic organ necrosis virus

[0045] 1. Construction of the recombinant plasmid as a positive control.

[0046] The target gene was ligated into the T vector, and the ligated product was transformed into Escherichia coli DH5α competent cells, and the recombinant plasmid was screened by the blue-white spot technique. Purify the recombinant plasmid using a commercial plasmid purification kit.

[0047] A positive control sample and a negative control sample were set up for each group of samples. The positive control sample is the above-mentioned recombinant plasmid; the negative control sample is deionized water.

[0048] 2. Determine the optimal conditions according to the Ct value and the strength of the fluorescent signal, and combine the best conditions as the final optimized system.

[0049] The annealing temperature is optimized from 55°C to 65°C; mg2+ The conc...

Embodiment 3

[0058] Example 3 Characteristic Evaluation of Goldfish Hematopoietic Necrosis Virus Fluorescent Quantitative PCR Detection Method

[0059] 1. Sensitivity evaluation, sensitivity is the lowest detection limit of real-time PCR.

[0060] The concentration of positive reference DNA stock solution is 10 10 copies / μL. First dilute it 10 times in a gradient to 10copies / μL, and then use the solution of each dilution as a template to amplify using the fluorescent quantitative PCR method established in Example 2 of the present invention, and determine the minimum detectable template amount of the method . According to the detection results, the fluorescent quantitative PCR method can detect at least 100 copies of the DNA template.

[0061] 2. Specificity evaluation.

[0062] Adopt the fluorescent quantitative PCR method that the embodiment of the present invention 2 establishes, to goldfish hematopoietic organ necrosis virus, koi herpes virus (KHV), infectious hematopoietic organ ne...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting goldfish haematopoietic necrosis virus. The invention provides a real-time fluorescence quantitative PCR (Polymerase Chain Reaction) primer and a probe for detecting goldfish haematopoietic necrosis virus at first, wherein the sequences are respectively represented by SEQ ID NO2, SEQ ID NO3 and SEQ ID NO4. The invention further provides a method for detecting goldfish haematopoietic necrosis virus by using the primer and the probe through fluorescence quantitative PCR. The detection method and the detection kit disclosed by the invention have the advantages of being accurate to detect, high in sensitivity and specificity, simple, convenient and rapid, and have good clinical sample detection capability.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to fluorescent quantitative PCR primers and probes for detecting goldfish hematopoietic organ necrosis virus, and the present invention also relates to methods and methods for using the primers and probes to detect goldfish hematopoietic organ necrosis virus Reagent test kit. Background technique [0002] Goldfish haematopoietic necrosis virus (GFHNV), also known as cyprinid herpesvirus 2 (CyHV-2), is the pathogen of goldfish haematopoietic necrosis (GFHN). A highly pathogenic double-stranded DNA virus infecting goldfish (Carassius auratus), crucian carp (Carassius auratus) and their variants. The virus once broke out in Japan, Australia, New Zealand, the United Kingdom, Hungary and my country's Taiwan, and the mortality rate of the diseased goldfish can reach 100%. [0003] At present, there is a lack of cell lines sensitive to GFHNV and antibodies against GFHNV at home and abroa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/705C12Q2545/101C12Q2563/107C12Q2561/101
Inventor 张旻景宏丽王娜吴绍强
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More