Kit for detecting goldfish haematopoietic necrosis virus and application thereof
A hematopoietic organ necrosis and kit technology, applied in the field of molecular biology, can solve the problems of false negative test results, ethidium bromide contamination, nucleic acid contamination, etc., and achieve the effects of improving the positive rate, good repeatability and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The design of embodiment 1 goldfish hematopoietic organ necrosis virus specific primer and probe
[0039] Comparing the DNA sequences of known specific genes of goldfish hematopoietic necrosis virus, screening out the specific sequence of goldfish hematopoietic necrosis virus gene, which is a conserved sequence (2307-2464) in the main capsid protein (MCP) gene of GFHNV , the nucleotide sequence of which is shown in SEQ ID NO.1. When designing primers and probes, care should be taken to avoid mutation points in the sequence. After repeated screening and verification, a pair of fluorescent quantitative PCR primers and probes used in conjunction with the primers were obtained for the detection of goldfish hematopoietic organ necrosis virus.
[0040] Upstream primer: CAAACCCAGCACCGTCAGATGGT (SEQ ID NO.2)
[0041] Downstream primer: ATCCGGCACAGGTGGCGTGT (SEQ ID NO. 3).
[0042] The fluorescent probe sequence is:
[0043] 5'-FAM-TTGGATCTGCTGCGCCCTGTTTGACAG-TAMRAN (SEQ ID N...
Embodiment 2
[0044] Example 2 Establishment of a fluorescent quantitative PCR detection method for detecting goldfish hematopoietic organ necrosis virus
[0045] 1. Construction of the recombinant plasmid as a positive control.
[0046] The target gene was ligated into the T vector, and the ligated product was transformed into Escherichia coli DH5α competent cells, and the recombinant plasmid was screened by the blue-white spot technique. Purify the recombinant plasmid using a commercial plasmid purification kit.
[0047] A positive control sample and a negative control sample were set up for each group of samples. The positive control sample is the above-mentioned recombinant plasmid; the negative control sample is deionized water.
[0048] 2. Determine the optimal conditions according to the Ct value and the strength of the fluorescent signal, and combine the best conditions as the final optimized system.
[0049] The annealing temperature is optimized from 55°C to 65°C; mg2+ The conc...
Embodiment 3
[0058] Example 3 Characteristic Evaluation of Goldfish Hematopoietic Necrosis Virus Fluorescent Quantitative PCR Detection Method
[0059] 1. Sensitivity evaluation, sensitivity is the lowest detection limit of real-time PCR.
[0060] The concentration of positive reference DNA stock solution is 10 10 copies / μL. First dilute it 10 times in a gradient to 10copies / μL, and then use the solution of each dilution as a template to amplify using the fluorescent quantitative PCR method established in Example 2 of the present invention, and determine the minimum detectable template amount of the method . According to the detection results, the fluorescent quantitative PCR method can detect at least 100 copies of the DNA template.
[0061] 2. Specificity evaluation.
[0062] Adopt the fluorescent quantitative PCR method that the embodiment of the present invention 2 establishes, to goldfish hematopoietic organ necrosis virus, koi herpes virus (KHV), infectious hematopoietic organ ne...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com