Molecular identification method used for siniperca chuatsi, siniperca scherzeri and hybrid f1 of siniperca chuatsi and siniperca scherzeri

A technology of molecular identification and cocked mandarin fish, which is applied in the determination/inspection of microbes, biochemical equipment and methods, etc., can solve the problems of mixed germplasm and difficult identification, and achieve moderate price, reduced detection time, and wide applicability Effect

Inactive Publication Date: 2015-05-20
HUAZHONG AGRI UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a molecular identification method for the first generation of Siniperca sinensis, Siniperca sinensis and their hybrids. and the first generation of hybrids of Siniperca sinensis) identification and the problem of germplasm mixing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular identification method used for siniperca chuatsi, siniperca scherzeri and hybrid f1 of siniperca chuatsi and siniperca scherzeri
  • Molecular identification method used for siniperca chuatsi, siniperca scherzeri and hybrid f1 of siniperca chuatsi and siniperca scherzeri
  • Molecular identification method used for siniperca chuatsi, siniperca scherzeri and hybrid f1 of siniperca chuatsi and siniperca scherzeri

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] A method for molecular identification of mandarin mandarin fish, mandarin mandarin fish and their hybrid offspring, the steps are:

[0030] 1. Genomic DNA extraction:

[0031] Cut about 0.5 mg of fin ray tissue from each fish, and extract genomic DNA according to the method and steps shown in the blood, cell, tissue genomic DNA extraction kit (spin column type) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd., and use The concentration of DNA was detected by ultraviolet spectrophotometer, and the purity of DNA was detected by agarose gel with a concentration of 1.5%.

[0032] 2. Amplification of target DNA fragments:

[0033] That is, PCR is performed.

[0034] 1) The sequence of a pair of microsatellite primers used in PCR reaction is:

[0035] Primer forward sequence: 5'ATGTAACCGTAAGTGACCTC3',

[0036] Primer reverse sequence: 5'TGTTGTTCAGACGATGACGA3'.

[0037] 2) The PCR reaction system is as follows:

[0038]

[0039]

[0040] Mix and centr...

Embodiment 2

[0049] A verification example of a molecular identification method for Siniperca sinensis, Siniperca sinensis and their hybrid offspring, the steps are:

[0050] 1. Sample source and extraction of genomic DNA:

[0051] 33 mandarin fishes (11 parents of mandarin fish with cocked mouth, 10 parents of mandarin mandarin fish with cocked mouth, 12 offsprings of hybrids of mandarin fish with cocked mouth and mandarin mandarin fish with cocked mouth, 12 offsprings of mandarin mandarin fish with cocked mouth and children of spotted mandarin fish) from Yushun Farming and Animal Husbandry in Qingyuan, Guangdong Fishery Science and Technology Service Co., Ltd. fishery harvested. Cut about 0.5 mg of fin ray tissue from each fish, and extract genomic DNA according to the method and steps shown in the blood, cell, tissue genomic DNA extraction kit (spin column type) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd., and use The concentration of DNA was detected by ultraviolet ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular identification method used for siniperca chuatsi, siniperca scherzeri and a hybrid f1 of the siniperca chuatsi and the siniperca scherzeri. The molecular identification method used for the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri comprises the following steps: 1) extracting a genome DNA of a to-be-detected mandarin fish (the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri) sample; 2) with the extracted genome DNA of the to-be-detected sample as a template, amplifying a DNA target fragment by adopting polymerase chain reaction (PCR), wherein a pair of microsatellite primer sequences used in the PCR are as follows: a forward primer sequence, namely 5'ATGTAACCGTAAGTGACCTC3', and a reverse primer sequence, namely 5'TGTTGTTCAGACGATGACGA3'; 3) carrying out electrophoretic separation on the PCR product by adopting 8% non-denatured polyacrylamide gel, then carrying out silver staining, and photographing to record an electrophoresis result; and 4) comparing with a map of a standard digestion fragment, reading out the position of a target stripe of the to-be-detected mandarin fish sample, and respectively identifying the to-be-detected mandarin fish sample to be the siniperca chuatsi, the siniperca scherzeri or the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri. The molecular identification method used for the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri is easy and simple to operate, the defects of morphological identification are made up, and the problems that a hybrid mandarin fish (the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri) is difficult to identify and varieties are miscellaneous during aquaculture are solved.

Description

technical field [0001] The invention belongs to the technical field of identification of fish species in aquaculture, and in particular relates to a molecular identification method for mandarin fish, mandarin fish and their hybrid offspring. Background technique [0002] Siniperca chuatsi Basilewsky and Siniperca scherzeri Steindachner belong to the order Perciformes, Siniperidae and Siniperidae, and Sinipercae are naturally only distributed in East Asia (China, North Korea, Korea, Japan, Vietnam (Red River )) and the Russian Far East. The cocked mandarin fish and the spotted mandarin fish are delicious, nutritious, without intermuscular thorns, and the market price is high, and the export demand is large. They are traditional freshwater cultured rare fish in my country. The cocked mandarin fish is large in size and fast in growth, but weak in disease resistance; the spotted mandarin fish is easy to tame and strong in stress resistance, but it grows slowly and has a long br...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q1/6888C12Q2600/156C12Q2531/113C12Q2565/125
Inventor梁旭方窦亚琪吕丽媛杨敏田昌绪郑荷子赵程张进
OwnerHUAZHONG AGRI UNIV