Molecular identification method used for siniperca chuatsi, siniperca scherzeri and hybrid f1 of siniperca chuatsi and siniperca scherzeri

Abstract

The invention discloses a molecular identification method used for siniperca chuatsi, siniperca scherzeri and a hybrid f1 of the siniperca chuatsi and the siniperca scherzeri. The molecular identification method used for the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri comprises the following steps: 1) extracting a genome DNA of a to-be-detected mandarin fish (the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri) sample; 2) with the extracted genome DNA of the to-be-detected sample as a template, amplifying a DNA target fragment by adopting polymerase chain reaction (PCR), wherein a pair of microsatellite primer sequences used in the PCR are as follows: a forward primer sequence, namely 5'ATGTAACCGTAAGTGACCTC3', and a reverse primer sequence, namely 5'TGTTGTTCAGACGATGACGA3'; 3) carrying out electrophoretic separation on the PCR product by adopting 8% non-denatured polyacrylamide gel, then carrying out silver staining, and photographing to record an electrophoresis result; and 4) comparing with a map of a standard digestion fragment, reading out the position of a target stripe of the to-be-detected mandarin fish sample, and respectively identifying the to-be-detected mandarin fish sample to be the siniperca chuatsi, the siniperca scherzeri or the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri. The molecular identification method used for the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri is easy and simple to operate, the defects of morphological identification are made up, and the problems that a hybrid mandarin fish (the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri) is difficult to identify and varieties are miscellaneous during aquaculture are solved.

Description

technical field [0001] The invention belongs to the technical field of identification of fish species in aquaculture, and in particular relates to a molecular identification method for mandarin fish, mandarin fish and their hybrid offspring. Background technique [0002] Siniperca chuatsi Basilewsky and Siniperca scherzeri Steindachner belong to the order Perciformes, Siniperidae and Siniperidae, and Sinipercae are naturally only distributed in East Asia (China, North Korea, Korea, Japan, Vietnam (Red River )) and the Russian Far East. The cocked mandarin fish and the spotted mandarin fish are delicious, nutritious, without intermuscular thorns, and the market price is high, and the export demand is large. They are traditional freshwater cultured rare fish in my country. The cocked mandarin fish is large in size and fast in growth, but weak in disease resistance; the spotted mandarin fish is easy to tame and strong in stress resistance, but it grows slowly and has a long br...

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a molecular identification method for the first generation of Siniperca sinensis, Siniperca sinensis and their hybrids. and the first generation of hybrids of Siniperca sinensis) identification and the problem of germplasm mixing

Images