Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Prokaryotic expression and application of lipase and immobilization method

A prokaryotic expression, lipase technology, applied in the field of enzyme engineering and molecular biology applications, can solve the problems of high cost, loss of enzyme activity, long time consumption, etc., to achieve improved stability and tolerance, wide substrate specificity, The effect of reducing steric hindrance

Active Publication Date: 2015-06-03
JIANGSU UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Enzyme immobilization technology is to adsorb or covalently bind enzymes to solid materials, or trap enzymes on organic or inorganic polymers, which is a very important way to improve enzyme stability, recyclability, etc., however It has some disadvantages that cannot be ignored: high cost and time-consuming enzyme immobilization procedure, loss of enzyme activity during recycling, etc.
However, the method of surface display of spores has some disadvantages: complex operation, low transformation success rate, low protein expression level, etc., and the use of shuttle expression vectors can solve this problem very well. Qu Yuanyuan et al. (Qu YY, Wang JW , Zhang ZJ, Shi SN, Li DX, Shen WL, Shen E, Zhou JT (2014) Catalytic transformation of hodas using an efficient meta-cleavage product hydrolase-spore surface display system. J Mol Catal B-Enzym 102: 204-210 .) By constructing a shuttle expression vector and using CotG as an anchor protein to display monohydrolase on the surface of spores, it showed better activity than purified free enzyme and enzyme immobilized on SBA-15 mesoporous material Enzyme Activity and Recycling Efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prokaryotic expression and application of lipase and immobilization method
  • Prokaryotic expression and application of lipase and immobilization method
  • Prokaryotic expression and application of lipase and immobilization method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1: Obtaining of lipase gene fragment

[0054] PCR primers were designed according to the gene sequence of Thermotoga maritima MSB8 lipase Tm1350 retrieved from NCBI (GenBank accession no. NP_229151.1) and the multiple cloning site (MCS) on the prokaryotic expression plasmid pET-28a. Using the biological software primer 5.0 to analyze the primers of the amplified lipase gene, design the upstream primer Tm1350-up and the downstream primer Tm1350-down,

[0055] Tm1350-up (BamHI): CGCGGATCCATGAGAATGAACATCCAGAAACACG,

[0056] Tm1350-down(XhoI): CCGCTCGAGTTATTTCCCTCCGAGTTTTTCGAGAC,

[0057] PCR reaction system (50 μL): PrimeSTAR® HS DNA Polymerase 0.5 μL, 5×PrimeSTAR Buffer 10 μL, dNTP Mixture 4 μL, Thermotoga maritima genome 0.5 μL, Tm350-up (10 μM) 1 μL, Tm350-down (10 μM) 1 μL, dd H2O33 μL. PCR program: 1) Pre-denaturation at 94°C for 3 min; 2) 30 cycles: 98°C for 10 s, 58°C for 10 s, 72°C for 1 min; 3) 72°C for 10 min.

[0058] PCR products were subjected...

Embodiment 2

[0059] Example 2: DNA recombination, expression and purification of lipase Tm1350 gene

[0060] (1) DNA recombination: restriction endonuclease Bam HI and xho I respectively digest the PCR product in Example 1 and the pET-28a (purchased from novagen) plasmid, then use T4 ligase to ligase the product, and transform the enzyme-ligated product connected overnight E. coli DH5α (purchased from GeneCopoeia) competent cells, select positive transformants for culture, extract the plasmid, and use double enzyme digestion and sequencing to determine that the lipase Tm1350 gene is correctly constructed into the expression vector, and the recombinant plasmid with successful sequencing is pET-28a -Tm1350.

[0061] figure 1 It is the agarose gel electrophoresis image of pET-28a-Tm1350 after double digestion, the size of pET-28a plasmid is 5358bp, and the size of Tm1350 gene fragment is 780 bp.

[0062] Transfer the successfully sequenced recombinant plasmids into E. coli BL2...

Embodiment 3

[0074] Embodiment 3: Refolding of recombinant protein

[0075] Cut the dialysis membrane into small pieces of appropriate length (15 cm), pay attention to wear gloves and do not touch the dialysis membrane directly; then put the dialysis membrane in 2% (w / v) NaHCO 3 Boil with 1mM EDTA (pH8.0) for 10min, wash the dialysis membrane thoroughly with distilled water, then put it into 1mM EDTA (pH8.0) and boil for 10min; after washing with distilled water, put the recombinant protein liquid purified and recovered above into dialysis Then put the dialysis membrane into different dialysis buffers one by one, and put it in the refrigerator at 4°C for 6 hours each time, and the urea concentrations were 8M, 4M, 2M, 1M, 0.5M, 0.25M, 0M , and finally dialyzed in saline / distilled water at 4°C for 6h; the dialyzed protein was aliquoted and stored at -70°C. The dialysis membrane was cleaned with distilled water, soaked in 50% glycerin, and stored in a refrigerator at 4°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to prokaryotic expression and application of lipase and an immobilization method, and belongs to the fields of enzyme engineering and molecular biology application. A lipase Tm1350 gene is derived from an extreme thermophilic bacterium. The method comprises the following steps: constructing the gene in a prokaryotic expression carrier pET-28a, obtaining a recombinant plasmid pET-28a-Tm1350, transferring into a host cell E.coli BL21, and inducing expression of the recombinant lipase; purifying and identifying the enzymatic property; and constructing a shuttle expression vector pHS-CotB-Tm1350 with a high copy number, transferring into a bacillus subtilis strain DB403, inducing generation of recombinant spores, and assembling along with capsid protein CotB, wherein the enzyme is co-expressed on the spore surfaces. According to the immobilization method, lipase is immobilized through a spore surface technology for the first time; the lipase has good heat stability, alkali resistance, methanol activity and methanol resistance, and has great industrialized application potential, for example, preparation of biodiesel. The enzyme is shown on the spore surfaces, is relatively good in stability, can be recycled by simple centrifugation or filtration, and has a good application prospect.

Description

technical field [0001] The invention relates to a prokaryotic expression, application and immobilization method of lipase, belonging to the fields of enzyme engineering and molecular biology applications. Background technique [0002] Lipase is a kind of serine hydrolase that can catalyze the hydrolysis and synthesis of ester bonds, and is widely found in animals, plants and microorganisms. However, microbial lipase has incomparable characteristics of animals and plants: it has rich sources of species, low production cost, wide range of pH and temperature stability, and wide substrate specificity. It is widely used in food, oil, fat, and chiral compounds. , leather, cosmetics, biodiesel and other industrial production. However, most of the industrial enzymes now come from mesophilic microorganisms, which are not suitable for harsh industrial production procedures, such as in the environment of organic reagents and high temperature. [0003] The biocatalytic thermal stabili...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N1/21C12N9/20C12N15/75C12N11/16C12R1/19C12R1/125
Inventor 陈华友田瑞张天喜倪忠张清孙腾云陈志陈克平杨胜利
Owner JIANGSU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com