Trichosporon montevideense and application of trichosporon montevideense in synthesis of gold nanoparticles
A gold nanoparticle, yeast technology, applied in the biological field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Example 1: Strain acquisition
[0019] Trichosporon in this application is isolated from the activated sludge of Benxi Iron and Steel Coking Plant. In the early stage, the mud sample was placed in a microbial reactor for domestication and cultivation. After 60 days, 2 mL of the mud-water mixture in the reactor was taken, and the mud-water mixture was diluted and coated on the solid modified Martin containing tetracycline and oxytetracycline by the plate dilution coating method. Liquid medium (glucose 10 g / L, (NH 4 ) 2 SO 4 1 g / L, MgSO 4 0.5 g / L, K 2 HPO 4 1 g / L, tetracycline 0.05 g / L; oxytetracycline 0.05 g / L, pH 7, agar 2 wt%), cultured at 30°C for 5 days. After the colonies grow out of the petri dish, pick a small amount of colonies and place them in a 50 mL Erlenmeyer flask containing 25 mL of liquid modified Martin's medium, shake and culture at 30°C and 150 rpm, wait until the strain grows to the logarithmic growth phase, absorb a small amount of bacteri...
Embodiment 2
[0021] Example 2: 26S rRNA molecular identification of strains
[0022] Genomic DNA of Trichosporium yeast WIN was extracted, the 26S rRNA gene sequence was amplified by PCR and sequenced, and the sequence was compared using BLAST program, and the most similar species was Trichosporium yeast, and the 26S rRNA gene sequences of the two were The similarity was 100%, so it was determined that WIN was Trichosporon. figure 1 It is the phylogenetic tree of strain WIN gene. Its 26S rRNA sequence has been registered in GenBank database, accession number is KP676895. The 26Sr RNA gene sequence of strain WIN is as follows.
[0023] >WIN 26S rRNA gene sequence
[0024] CTCAAATTTGAAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGAAGCGTTTTCCGTGCTGAACTGTGTCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATCATCAGTGCTCTGTGATACGTTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAAC...
Embodiment 3
[0025] Example 3: Growth curve of Trichosporon yeast WIN
[0026] Utilize the bacterial solution in Example 1, adopt 115 ℃, 20 min autoclaved solid modified Martin medium containing tetracycline and oxytetracycline (glucose 10 g / L, (NH 4 ) 2 SO 4 1 g / L, MgSO 4 0.5 g / L, K 2 HPO 4 1 g / L, tetracycline 0.05 g / L; oxytetracycline 0.05 g / L, pH 7), 30 oC, cultured at 150 rpm, with an inoculum size of 10%. The growth of bacteria was detected by ultraviolet spectrophotometry at 660 nm absorbance of bacteria solution, the growth of strain WIN was as follows: figure 2 , the strain entered the stationary phase after 108 h of growth, and 12-108 h was the logarithmic growth phase.
PUM
| Property | Measurement | Unit |
|---|---|---|
| Length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More