Alginate lyase SHA-I gene and expression vector thereof

An alginate lyase and gene technology, which is applied in the directions of lyase, genetic engineering, plant genetic improvement, etc., can solve problems such as difficulty in meeting practical application requirements and low enzyme yield, and achieve easy industrial production, solve the problem of low enzyme yield, Easy to operate effect

Active Publication Date: 2015-08-12
KUNMING UNIV OF SCI & TECH
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the enzyme yield of the existing strains producing alginate lyase is relatively low, and it is difficult to meet the requirements of practical application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alginate lyase SHA-I gene and expression vector thereof
  • Alginate lyase SHA-I gene and expression vector thereof
  • Alginate lyase SHA-I gene and expression vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Marinicatena alginatilytica Preparation and Detection of SH-52 Genomic DNA

[0039] used in the present invention Marinicatena alginatilytica SH-52 is the strain screened by our laboratory, Marinicatena alginatilytica The preparation of SH-52 genomic DNA adopts the extraction method of common bacterial genome, and the specific content is as follows: Take 2 mL of overnight culture liquid at 4 ° C, centrifuge at 4000 rpm for 2 min, discard the supernatant, and collect the bacteria; add 100 μl Solution I suspension bacteria, 30 μl 10% SDS and 1μl 20mg / ml proteinase K, mix well, incubate at 37°C for 1h; add 100μl 15mol / L NaCl, mix well; add 20μl CTAB / NaCl solution (CTAB 10%, NaCl 0.7mol / L), mix well, 65°C, 10min; add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) to mix, centrifuge at 12000rpm for 5min; take the supernatant, add 2 times the volume of absolute ethanol, 0.1 times the volume of 3mol / L NaOAC, - Place at 20°C for 30 minutes; ce...

Embodiment 2

[0040] Example 2: Amplification and TA Cloning of Alginate Lyase SHA-I Gene

[0041] Amplification and cloning of alginate lyase SHA-I gene figure 2 As shown, first find out from the whole genome sequencing results SHA-I The full-length gene sequence, and design a pair of specific primers, the sequence is as follows:

[0042] SHA-I-F: GGATCC ATGAAAACCAATAAAATTCTG

[0043] SHA-I-R: GCGGCCGC TTAGTCATTCTTCGTGAAATAG

[0044] The 5' end primer has the GGATCC characteristic sequence, and thus forms the BamH I restriction site; the 3' end adds the GCGGCCGC characteristic sequence to form the Not I restriction site.

[0045] Add 10 ng of Marinicatena alginatilytica SH-52 genomic DNA was used as a template, and 50ng of specific primers SHA-I-F and SHA-I-R, 2.5ul dNTP (10mM), 2.5ul of Pfu reaction buffer and 0.5ul of pfu (5U / ul) polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), add double distilled water to make the final volume 25ul. Heated at 94°C for 3 minutes...

Embodiment 3

[0046] Example 3: Prokaryotic expression vector pGEX-4T-1- SHA-I build

[0047] pGEX-4T-1- SHA-I A build strategy such as Figure 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19-T- SHA-I , separated the cleaved vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19-T- SHA-I produced by cutting SHA-I The DNA fragment of the gene (about 1.1kb), and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and SHA-I The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- SHA-I . Use the ligation reaction mixture to transform high-efficiency E. coli competent cells Trans1-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), and spread the transformed E. coli on a plate with ampicillin (Amp, 100ug / ml) , cultivated overnight at 37°C, screened Amp-resistant recombinant colonies, and extracted plasmids from Amp-re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alginate lyase SHA-I gene with a nucleotide sequence shown in SEQ ID NO: 1. The invention constructs a prokaryotic expression vector of the alginate lyase gene (i) SHA-I, and the prokaryotic expression vector is capable of acquiring an expression product alginate lyase SHA-I in a relatively short time, and has broad substrate specificity that PolyM and PolyG can both be used as a substrate. The alginate lyase has enzyme activity reaching 13U / mg and is a bifunctional enzyme with broad prospect. The prokaryotic expression vector and the overall expression system provided by the invention are easy to operate, and convenient for industrial production.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, in particular to an alginate lyase SHA-I gene and its prokaryotic expression vector pGEX-4T- SHA-I , the vector highly expresses the alginate lyase protein SHA-I. Background technique [0002] In recent years, the use of marine biomass --- seaweed to ferment ethanol has been gradually accepted by people and is called the third generation biofuel. As an ideal raw material for bioenergy production, seaweed has the following advantages: (1) high photosynthetic efficiency, fast growth, high yield, and abundant resources; (2) growth does not use cultivated land; (3) almost no lignin, cellulose The content is very small, the pretreatment is simple, and it is convenient for the utilization and fermentation of microorganisms. At present, the methods of alginic acid degradation can be divided into three categories: one is the chemical degradation method, and the acid hydrolysis method is wid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/60C12N15/70C12N9/88
Inventor伊日布斯李卫娜申冬玲何漫漫李曙梅严金平
OwnerKUNMING UNIV OF SCI & TECH