Supercharge Your Innovation With Domain-Expert AI Agents!

cry1ia gene and application thereof, cry1ia protein coded by cry1ia gene, and preparation method and application thereof

A gene and protein technology, applied in botany equipment and methods, biochemical equipment and methods, applications, etc., can solve the problems of unidentified nematode active protein, difficulty in wide application, low protein yield, etc., to reduce nematode resistance Drug properties, reduction of pesticide residues, and high lethality

Inactive Publication Date: 2015-09-30
HUNAN PLANT PROTECTION INST
View PDF1 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the parasporal crystal protein produced by this strain is a mixture of multiple components, not only the specific nematicidal active protein is not clear, but also the protein yield is low, which makes it difficult for the parasporal crystal extract to be widely used in the control of plant parasitic nematodes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • cry1ia gene and application thereof, cry1ia protein coded by cry1ia gene, and preparation method and application thereof
  • cry1ia gene and application thereof, cry1ia protein coded by cry1ia gene, and preparation method and application thereof
  • cry1ia gene and application thereof, cry1ia protein coded by cry1ia gene, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] A cry1Ia gene isolated from Bacillus thuringiensis YC-10, the Bacillus thuringiensis in this example is preserved in the China Center for Type Culture Collection, the address of the preservation unit is located at Wuhan University, China, and the preservation date is January 21, 2010, The preservation name is Bacillus thuringiensis YC-10, and the preservation number is CCTCC NO: M 2010023.

[0051] In Example 1, the root-knot nematode was isolated from the root of a healthy tobacco plant in the field, and the nutrient agar medium was preserved for future use. The strain grows well on the nutrient agar medium. When cultured at a constant temperature at 30°C for 2 days, the diameter of the colony can reach 0.2cm to 0.5cm. According to the scanning electron microscope, the bacteria are short rod-shaped, without flagella, and the size is (1.0~1.2)×(2.0~4.0) μm (see figure 1 ); the strain produces ellipsoid spores and is nearly mesogenic; the strain is G+, catalase reaction...

Embodiment 2

[0060] A kind of protein encoded by the cry1Ia gene of embodiment 1, its preparation method specifically comprises the following steps:

[0061] (1) PCR:

[0062] 1.1 Design primers:

[0063] F: 5’—GCTTTATTTGACATTACAGCTAAGTAT—3’

[0064] R: 5'—TAAATTTCATCCTACATCTAATCACTC—3'

[0065] 1.2 Amplification:

[0066] Use the DNA extracted in step 1 as a template to perform PCR amplification to obtain a PCR amplified fragment. The specific PCR reaction system and amplification conditions are as follows:

[0067] reaction system:

[0068]

[0069] PCR reaction conditions: 94°C×3min→(94°C×45s→52°C×60s→72°C×90s)×35 cycles→72°C×10min→4°C.

[0070] 1.3 Perform 1.0% agarose gel electrophoresis detection on the PCR product obtained in step 1.2. For the results, see figure 2 . From figure 2 It can be seen that there is a single band at 2200bp, which is consistent with the expected fragment size.

[0071] (2) Construction of recombinant plasmids, construction process see image...

Embodiment 3

[0095] A kind of application of the Cry1Ia protein of embodiment 2 in preventing and treating root-knot nematode J2, the specific application method is:

[0096] (1) Collection of M. incognita J2 and soybean cyst nematode J2

[0097] Meloidogyne incognita is used to multiply and preserve the population of peppers grown in pots in the laboratory. When a large number of root knots appear on the root system of peppers, take out the root system, rinse gently with water, remove the oocysts, and disinfect in 0.5% sodium hypochlorite for 3 minutes. Rinse 3 times, put them into an incubation tank made of 200-mesh steel mesh, put them in a petri dish, add sterilized water, and incubate at a constant temperature of 25°C. After 3 days, collect newly hatched M. incognita J2 every 24 hours for future use.

[0098] (2) Preparation of protein solution:

[0099] Experimental group: the protein solution of Example 2 was diluted to concentrations of 5.0 mg / L, 10.0 mg / L, 20.0 mg / L, 40.0 mg / L an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cry1Ia gene and application thereof, a Cry1Ia protein coded by cry1Ia gene, and a preparation method and application thereof. The nucleotide sequence of the cry1Ia gene is disclosed as SEQ ID NO.1. The preparation method of the Cry1Ia protein coded by the cry1Ia gene comprises the following steps: carrying out PCR (polymerase chain reaction) amplification by using primers disclosed as SEQ ID NO.3 and SEQ ID NO.4, connecting with a vector to obtain a recombinant, transforming into Escherichia coli to obtain a transformant, culturing, collecting the thallus, crushing and taking the Cry1Ia protein. The cry1Ia gen and Cry1Ia protein can be used for controlling parasitic nematodes, have the advantages of high efficiency, low toxicity, environment friendliness and the like, and can effectively reduce pesticide residues.

Description

technical field [0001] The invention relates to the technical field of microbes, in particular to cry1Ia gene and its application, the application of the Cry1Ia protein encoded by the cry1Ia gene and the encoded protein in the control of parasitic nematodes. Background technique [0002] Plant parasitic nematodes are one of the important diseases of crops. Global crop losses caused by plant parasitic nematodes exceed 100 billion U.S. dollars each year (Chiwold, 2003), and nematode diseases have become a prominent problem in agricultural production. At present, chemical nematicides are often used in agricultural production to prevent and control plant parasitic nematode diseases, but the varieties of nematicides on the market today are limited, and most of them are highly toxic and high residual pesticides. Nematicides have not only caused serious pollution to the environment, but also caused a series of environmental and social problems such as excessive pesticide residues ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/32C07K14/325C12N15/70A01N47/44A01P5/00
Inventor 成飞雪刘勇张德咏宋志强
Owner HUNAN PLANT PROTECTION INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More