cry1ia gene and application thereof, cry1ia protein coded by cry1ia gene, and preparation method and application thereof
A gene and protein technology, applied in botany equipment and methods, biochemical equipment and methods, applications, etc., can solve the problems of unidentified nematode active protein, difficulty in wide application, low protein yield, etc., to reduce nematode resistance Drug properties, reduction of pesticide residues, and high lethality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] A cry1Ia gene isolated from Bacillus thuringiensis YC-10, the Bacillus thuringiensis in this example is preserved in the China Center for Type Culture Collection, the address of the preservation unit is located at Wuhan University, China, and the preservation date is January 21, 2010, The preservation name is Bacillus thuringiensis YC-10, and the preservation number is CCTCC NO: M 2010023.
[0051] In Example 1, the root-knot nematode was isolated from the root of a healthy tobacco plant in the field, and the nutrient agar medium was preserved for future use. The strain grows well on the nutrient agar medium. When cultured at a constant temperature at 30°C for 2 days, the diameter of the colony can reach 0.2cm to 0.5cm. According to the scanning electron microscope, the bacteria are short rod-shaped, without flagella, and the size is (1.0~1.2)×(2.0~4.0) μm (see figure 1 ); the strain produces ellipsoid spores and is nearly mesogenic; the strain is G+, catalase reaction...
Embodiment 2
[0060] A kind of protein encoded by the cry1Ia gene of embodiment 1, its preparation method specifically comprises the following steps:
[0061] (1) PCR:
[0062] 1.1 Design primers:
[0063] F: 5’—GCTTTATTTGACATTACAGCTAAGTAT—3’
[0064] R: 5'—TAAATTTCATCCTACATCTAATCACTC—3'
[0065] 1.2 Amplification:
[0066] Use the DNA extracted in step 1 as a template to perform PCR amplification to obtain a PCR amplified fragment. The specific PCR reaction system and amplification conditions are as follows:
[0067] reaction system:
[0068]
[0069] PCR reaction conditions: 94°C×3min→(94°C×45s→52°C×60s→72°C×90s)×35 cycles→72°C×10min→4°C.
[0070] 1.3 Perform 1.0% agarose gel electrophoresis detection on the PCR product obtained in step 1.2. For the results, see figure 2 . From figure 2 It can be seen that there is a single band at 2200bp, which is consistent with the expected fragment size.
[0071] (2) Construction of recombinant plasmids, construction process see image...
Embodiment 3
[0095] A kind of application of the Cry1Ia protein of embodiment 2 in preventing and treating root-knot nematode J2, the specific application method is:
[0096] (1) Collection of M. incognita J2 and soybean cyst nematode J2
[0097] Meloidogyne incognita is used to multiply and preserve the population of peppers grown in pots in the laboratory. When a large number of root knots appear on the root system of peppers, take out the root system, rinse gently with water, remove the oocysts, and disinfect in 0.5% sodium hypochlorite for 3 minutes. Rinse 3 times, put them into an incubation tank made of 200-mesh steel mesh, put them in a petri dish, add sterilized water, and incubate at a constant temperature of 25°C. After 3 days, collect newly hatched M. incognita J2 every 24 hours for future use.
[0098] (2) Preparation of protein solution:
[0099] Experimental group: the protein solution of Example 2 was diluted to concentrations of 5.0 mg / L, 10.0 mg / L, 20.0 mg / L, 40.0 mg / L an...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
