Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Clonostachys rosea engineering strain for transforming chitinase gene, and applications thereof

A technology of chitinase gene and engineering strains, which is applied in genetic engineering, application, plant gene improvement, etc., can solve the problems of unstable control effect and limited disease resistance of Clonosporium pinkhelix, and achieve improved and stable control effect resistance, good control effect, and the effect of enhancing disease resistance

Active Publication Date: 2015-10-21
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a chitinase gene-transferred Clonosporium rosea engineering strain, which solves the problems of limited disease resistance and unstable control effect of Clonosporium rosea.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clonostachys rosea engineering strain for transforming chitinase gene, and applications thereof
  • Clonostachys rosea engineering strain for transforming chitinase gene, and applications thereof
  • Clonostachys rosea engineering strain for transforming chitinase gene, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Isolation and Identification of the Target Gene of Chitinase

[0022] The Clonosporium rosea HLD-1 strain was transferred to PDA medium. The composition of PDA medium was: potato 200g / L, glucose 20g / L, agar 20g / L, placed in a constant temperature incubator at 26°C for 7 days, Mycelium was collected with a spatula, DNA was extracted by CTAB method, and RNA was extracted by Trizol method. Using RNA as a template, cDNA was obtained using a cDNA reverse transcription kit.

[0023] Using DNA and cDNA sequences as templates, design primers at both ends of the target gene of chitinase, chiF (5′-3′): TTCAGAGTAGGCTTTTGGATTGGT, chiR: ACCCCATATTTGCTCATAATCACA, PCR amplifies chitinase DNA and cDNA respectively. PCR conditions were: pre-denaturation at 94°C for 4 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 2 minutes. Finally, it was kept at 72°C for 10 min to end the amplification reaction.

[00...

Embodiment 2

[0027] Construction and verification of chitinase overexpression vector

[0028] The promoter and terminator fragments were amplified from the target pAN7-1 vector, detected by agarose gel electrophoresis, and recovered by cutting the gel. The pEASY Uni Seamless Cloning and Assembly Kit was used to fuse and splice the linearized pAN7-1 vector and the chitinase target gene fragment to construct an overexpression vector. The constructed vector was transformed into Escherichia coli competent cells, cultured overnight at 37°C, clones were randomly selected to extract plasmids, and verified by HindIII digestion.

Embodiment 3

[0030] Preparation and Screening of Engineering Strain Cr-chi32

[0031] Clonosporium rosea HLD-1 was inoculated on PDA medium and cultured for 7 days until sporulation. The spores were eluted with sterile double distilled water, 1 ml was inoculated in PD liquid medium, and cultured at 26°C for 12 hours. Pass the bacterial solution through a 500-mesh sieve to collect the mycelia, wash with sterile water three times, then rinse with 0.7M sodium chloride osmotic pressure stabilizer to balance it, and collect the mycelium.

[0032] Use a sterile tip to pick the mycelium into the enzymatic hydrolysis solution containing 40mg / ml helicase, vortex fully, and enzymatically hydrolyze at 100r / min in a shaker at 28°C for 3h, and check the release of protoplasts every 1h. After enzymatic hydrolysis, add an equal volume of osmotic pressure stabilizer to dilute to avoid excessive enzymatic hydrolysis. Use miracloth to filter cell debris, transfer the filtrate to a 50ml centrifuge tube, cen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a clonostachys rosea engineering strain for transforming chitinase gene, wherein the strain is named Cr-chi32 and has the preservation number of CGMCC No.10027 in the China General Microbiological Culture Collection Center. The engineering strain Cr-chi32 has effects of enhancing of disease resistance of clonostachys rosea and improvement of prevention effect stability, can be effectively used for prevention and control of plant diseases, particularly for prevention and control of Sclerotinia and Botrytis cinerea of crops, and further provides good prevention and control effects on wilt, root rot, and other plant fungal diseases.

Description

technical field [0001] The invention belongs to the technical field of biological engineering and biological control, in particular to a chitinase gene-transferred Clonospora rosea engineering strain and its application in plant disease control. Background technique [0002] Clonostachys rosea, formerly known as: Gliocladium roseum, is an important class of plant disease biocontrol antagonistic microorganisms. It can parasitize a variety of plant pathogenic fungi such as Sclerotinia, Rhizoctonia, Fusarium, Botrytis cinerea, etc., and inhibit fungal diseases by producing antibacterial substances, competing, and inducing plant resistance. However, in the prior art, there is a lack of highly pathogenic strains, a lack of key technologies for large-scale cultivation of excellent strains, and insufficient product stability, which restricts the wide application of such biocontrol agents in the field of plant disease control. [0003] Mycoparasites secrete a series of cell wall de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N15/80C12N15/56A01N63/04A01P3/00C12R1/645
Inventor 李世东孙漫红孙占斌
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products