Unlock instant, AI-driven research and patent intelligence for your innovation.

Candida tropicalis gene engineering bacteria for high yield of xylitol and application of xylitol

A technology of Candida tropicalis and engineering bacteria, applied in the direction of genetic engineering, application, plant genetic improvement, etc., can solve the problems of low conversion rate and unsatisfactory effect, and achieve the effect of improving conversion rate and fast cell growth

Inactive Publication Date: 2015-11-18
JIANGNAN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the biggest disadvantage of using Candida tropicalis to produce xylitol is that the conversion rate is not high. Generally, the conversion rate of xylitol using xylose as raw material by microbial conversion method is 65%-85%.
Domestically, there is a method to increase the production of xylitol by increasing the copy number of the coenzyme gene, but the effect is not very satisfactory

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Candida tropicalis gene engineering bacteria for high yield of xylitol and application of xylitol
  • Candida tropicalis gene engineering bacteria for high yield of xylitol and application of xylitol
  • Candida tropicalis gene engineering bacteria for high yield of xylitol and application of xylitol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Embodiment 1 constructs Candida tropicalis genetically engineered bacterium

[0017] Primers UXYL2:TAAATAGAACCCACGAATCCCT and DXYL2:TTTACTCGTACTATGCACTCC were designed according to the sequence of the XYL2 gene, and the XYL2 gene was amplified from the Candida tropicalis DNA template by PCR technology, connected to pMD19TSimplevector (Dalian Bao Company) to obtain the recombinant plasmid pMD-XYL2, and the results of enzyme digestion and electrophoresis like figure 1 shown. Using the recombinant plasmid as a template, primers r1U:AACTGCAGAGTAGTGAATATCGGAACCACA and r1D:GCTCTAGAAACTTCCCAATTTCCGACT were used for reverse PCR amplification to obtain the target vector UDXYL2-Ts-UDXYL2 containing homology arms. The electrophoresis results were as follows: figure 2 shown. The hisG-URA3-hisG fragment whose sequence is shown in SEQIDNO.3 was connected with UDXYL2-Ts-UDXYL2 through PstI and XbaI double restriction sites, and then transformed into Escherichia coli competent cells...

Embodiment 2

[0021] Example 2 Candida tropicalis Genetic Engineering Bacteria Fermentation Production of Xylitol

[0022] Seed medium: YPD medium Fermentation medium composition: xylose 50g / L, glucose 10g / L, yeast extract 10g / L, KH 2 PO 4 5g / L, MgSO 4 ·7H 2 O0.2g / L.

[0023] Using YPD medium as the seed medium, inoculate a 250mL shake flask containing 50mL fermentation medium with a 5% inoculum amount, ferment at 30°C and 200rpm for 72h, and identify the contents of glucose, xylose and xylitol in the supernatant of the fermentation broth by HPLC content. During the growth process of the original strain XZX, almost all the xylose was used up, the xylitol yield was only 14.03g / L, and the actual conversion rate was only 28.06%. Xylitol production of Candida tropicalis genetically engineered strain XZX-4 with double-copy deletion of XYL2 reached 42.72g / L, and the actual conversion rate of xylose reached 99%

Embodiment 3

[0024] Example 3 Candida tropicalis genetically engineered bacteria utilize xylose mother liquor to produce xylitol

[0025] Seed medium: YPD medium Fermentation medium composition: xylose mother liquor (xylose 280g / L, glucose 85g / L) 200g / L, yeast extract 10g / L, peptone 10g / L, KH 2 PO 4 5g / L.

[0026] Use YPD medium as the seed medium, inoculate a 250mL shake flask containing 50mL fermentation medium with 5% inoculum, ferment and cultivate at 30°C and 200rpm for 96h, and identify the content of glucose, xylose and xylitol in the supernatant of the fermentation broth by HPLC content. During the growth process of the original strain XZX, almost all the xylose was used up, the xylitol yield was only 11.2g / L, and the actual conversion rate was only 28.7%. The xylitol production of Candida tropicalis genetically engineered strain XZX-4 with double-copy deletion of XYL2 reaches 34.5g / L, and the actual conversion rate of xylose reaches 95%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses candida tropicalis gene engineering bacteria for high yield of xylitol and an application of the xylitol and belongs to the technical field of biological production of sweetening agents. Expression of xylitol alcohol dehydrogenase genes is fundamentally prevented by deleting alcohol dehydrogenase genes, a metabolic pathway of xylitol is interrupted, accumulation of xylitol is realized, and the conversion rate of xylitol is increased remarkably. The candida tropicalis gene engineering bacteria can efficiently convert xylose into xylitol in a fermentation culture medium containing xylose, glucose, glycerin, arabinose and other mixed carbon sources, and the conversion rate is higher than 95%.

Description

technical field [0001] The invention relates to a genetically engineered strain of Candida tropicalis with high xylitol production and an application thereof, which belongs to the technical field of food sweetener biomanufacturing. Background technique [0002] Xylitol (Xylitol), also known as pentapentyl alcohol, is a five-carbon polyhydroxyl sugar alcohol, chemical formula C 5 h 12 o 5 , the shape is crystalline powder or white crystal, easily soluble in water, slightly sweet as sucrose, slightly soluble in methanol and ethanol, good thermal stability. Xylitol can be metabolized in the human body without the participation of insulin, and will not cause a sharp change in human blood sugar. Therefore, it can be used as a sweetener for diabetic foods, and has been widely used in chewing gum, gum, toffee , fudge, chocolate, jelly, cold drink, buccal tablet, mouthwash, throat medicine, cough syrup and other food, daily chemical and pharmaceutical industries; xylitol also has...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12P7/18C12N15/53C12R1/74
Inventor 陈献忠张利华陈振王均华强书敏沈微
Owner JIANGNAN UNIV