A Broad Spectrum Antifungal Bacillus and Its Application in Controlling Wheat Scab
A technology of wheat scab and bacillus, applied in the direction of application, bacteria, fungicides, etc., can solve the problems of failure of wheat scab control and other problems, and achieve the effects of pollution-free production and quality improvement
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Isolation and screening of Bacillus sp. DY26-010
[0028] The present invention relates to Bacillus sp. DY26-010 which is obtained by screening from sediment samples collected by the applicant from the 26th scientific expedition of China Ocean. The bacterium grows on LB medium, and after 24 hours of culture at 28°C, the bacterium is light yellow, translucent, with neat edges, smooth and shiny surface, and the colony morphology can be seen in figure 1 .
Embodiment 2
[0029] Embodiment 2: Bacillus sp. (Bacillus sp.) DY26-010 strain identification
[0030] Using the total DNA of Bacillus spp. DY26-020 as a template, its 16S rDNA sequence was amplified with bacterial universal primers. Universal primer 27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT. The PCR reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. After the amplified sequence was sequenced by a sequencing company, the 16S rDNA sequence of the strain was obtained. The sequence was compared with the nucleic acid data in the National Center for Biotechnology Information (NCBI) GeneBank (http: / / ncbi.nlm.nih.gov / blast). The comparison results showed that the DY26-010 16S rDNA sequence was compatible with Bacillus amyloliquefaciens(JQ245705.1), Bacillus amyloliquefaciens(HQ844506.1), Bacillus methylotrophicus(KC790301.1), Bacillus amyloliquefaciens(KC47891. ) and other strains have a sequence similari...
Embodiment 3
[0031] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum
[0032] The inhibitory activity of Bacillus sp. DY26-010 against 10 plant pathogenic fungi was determined by disc method. The tested pathogenic fungi were made into a fungus dish with a sterile puncher, inoculated in the center of a potato solid medium (PDA) plate, and cultured at 28°C. After the mycelium of the pathogenic fungus to be tested spreads and grows, a sterilized double-layer filter paper sheet (diameter 6 mm) is placed around the bacterial block, and the filter paper sheet is about 1 cm away from the edge of the mycelium.
[0033] Bacillus sp. (Bacillus sp.) DY26-010 of the present invention was cultivated on a shaker for 2 days, then centrifuged at 10,000 rpm for 10 min, filtered and sterilized to make a sterile fermentation supernatant, which was added dropwise on each filter paper sheet, 50 μL / filter paper sheet . Continue culturing at 28°C for 24 hours, and observe whether the...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com