Check patentability & draft patents in minutes with Patsnap Eureka AI!

A Broad Spectrum Antifungal Bacillus and Its Application in Controlling Wheat Scab

A technology of wheat scab and bacillus, applied in the direction of application, bacteria, fungicides, etc., can solve the problems of failure of wheat scab control and other problems, and achieve the effects of pollution-free production and quality improvement

Inactive Publication Date: 2018-10-09
THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, continuing to use carbendazim to control wheat scab will have the potential threat of control failure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Broad Spectrum Antifungal Bacillus and Its Application in Controlling Wheat Scab
  • A Broad Spectrum Antifungal Bacillus and Its Application in Controlling Wheat Scab
  • A Broad Spectrum Antifungal Bacillus and Its Application in Controlling Wheat Scab

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Isolation and screening of Bacillus sp. DY26-010

[0028] The present invention relates to Bacillus sp. DY26-010 which is obtained by screening from sediment samples collected by the applicant from the 26th scientific expedition of China Ocean. The bacterium grows on LB medium, and after 24 hours of culture at 28°C, the bacterium is light yellow, translucent, with neat edges, smooth and shiny surface, and the colony morphology can be seen in figure 1 .

Embodiment 2

[0029] Embodiment 2: Bacillus sp. (Bacillus sp.) DY26-010 strain identification

[0030] Using the total DNA of Bacillus spp. DY26-020 as a template, its 16S rDNA sequence was amplified with bacterial universal primers. Universal primer 27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT. The PCR reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. After the amplified sequence was sequenced by a sequencing company, the 16S rDNA sequence of the strain was obtained. The sequence was compared with the nucleic acid data in the National Center for Biotechnology Information (NCBI) GeneBank (http: / / ncbi.nlm.nih.gov / blast). The comparison results showed that the DY26-010 16S rDNA sequence was compatible with Bacillus amyloliquefaciens(JQ245705.1), Bacillus amyloliquefaciens(HQ844506.1), Bacillus methylotrophicus(KC790301.1), Bacillus amyloliquefaciens(KC47891. ) and other strains have a sequence similari...

Embodiment 3

[0031] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum

[0032] The inhibitory activity of Bacillus sp. DY26-010 against 10 plant pathogenic fungi was determined by disc method. The tested pathogenic fungi were made into a fungus dish with a sterile puncher, inoculated in the center of a potato solid medium (PDA) plate, and cultured at 28°C. After the mycelium of the pathogenic fungus to be tested spreads and grows, a sterilized double-layer filter paper sheet (diameter 6 mm) is placed around the bacterial block, and the filter paper sheet is about 1 cm away from the edge of the mycelium.

[0033] Bacillus sp. (Bacillus sp.) DY26-010 of the present invention was cultivated on a shaker for 2 days, then centrifuged at 10,000 rpm for 10 min, filtered and sterilized to make a sterile fermentation supernatant, which was added dropwise on each filter paper sheet, 50 μL / filter paper sheet . Continue culturing at 28°C for 24 hours, and observe whether the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses broad-spectrum fungus-resistant bacillus and application thereof to preventing wheat scab and relates to bacillus. The preservation number of the bacillus (Bacillus sp.)DY26-010 is CCTCC NO:M2015407. Supernatant liquid of the bacillus is antagonistic to fusarium spp, gloeosporium musarum, paecilomyces variotii, sclerotinia sclerotiorum, alternaria longipes, trichoderma viride, rhizoctonia, mutualism alternaria, botrytis cinerea and colletotrichum dematium. Fermentative supernatant liquid of the bacillus DY26-010 has high antagonism on pathogenic bacteria and fusarium spp of wheat scab, the preventing effect can be 57.1% in a potted experiment of wheat scab, and the bacillus can be used for preparing the fermentative supernatant liquid applied to preventing wheat scab. A biological prevention method of wheat scab is provided, no chemical pesticide is used, the bacillus has the advantages of being non-toxic, not prone to forming a pesticide-resistant environment, biologically safe and the like, and application prospects are good.

Description

technical field [0001] The invention relates to bacillus, in particular to a broad-spectrum antifungal bacillus DY26-010 and its application in preventing and treating wheat scab. Background technique [0002] Wheat head blight is a major wheat disease caused by Fusarium fungi. Its occurrence will not only cause wheat yield reduction, but also threaten human and animal safety due to the toxins (such as DON, etc.) produced by Fusarium. There are many rainy days during the flowering period of wheat, and wheat scab is greatly affected by climatic factors. Rainfall and airflow provide favorable conditions for the occurrence and prevalence of wheat scab, but also bring many difficulties to chemical control (Chen Huabao, Xiao Fangqiong, Xie Ting , et al. Inhibitory activity of wheat endophytes against wheat head blight[J]. Northwest Agricultural Journal, 2011,20(7):46-49). In addition, there are certain difficulties in conventional breeding in breeding disease-resistant varieties...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/00A01P3/00
Inventor 陈新华吴小君郭文斌
Owner THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More