Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Biological sensor for detecting tetracycline on basis of aptamer specificity and preparation method of biological sensor

A technology of biosensor and nucleic acid aptamer, which is applied in the field of biosensor and its preparation based on the specific detection of tetracycline based on nucleic acid aptamer, can solve the problems of difficulty in ensuring electrode uniformity, time-consuming and labor-intensive, etc., and achieve the goal of promoting electron transfer, catalysis The effect of high activity and good signal amplification

Inactive Publication Date: 2016-01-06
SHANGHAI JIAO TONG UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ordinary solid electrodes used in this technology require pretreatment steps such as grinding, activation, and cleaning before each use, which is time-consuming and laborious, and the uniformity of the electrodes after pretreatment is difficult to guarantee

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological sensor for detecting tetracycline on basis of aptamer specificity and preparation method of biological sensor
  • Biological sensor for detecting tetracycline on basis of aptamer specificity and preparation method of biological sensor
  • Biological sensor for detecting tetracycline on basis of aptamer specificity and preparation method of biological sensor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] This embodiment includes the following steps:

[0041] 1) Ultrasonic dispersion of 3.75 mg of ferric oxide / reduced graphene oxide in 10 mL of 2.0 mg / mL sodium alginate aqueous solution to obtain a uniform composite of ferric oxide / reduced graphene oxide-sodium alginate;

[0042] 2) 3 μL of ferric oxide / reduced graphene oxide‐sodium alginate complex was modified onto the surface of the working electrode, and dried at room temperature to form a film;

[0043]3) Coat 3 μL of tetracycline aptamer with a concentration of 5.0 μmol / L [sequence 5′‐CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG‐3′(76‐mer)] on the surface modified with ferric oxide / reduced graphene oxide‐sodium alginate The surface of the composite working electrode was dried to form a film at room temperature and cleaned.

Embodiment 2

[0045] The nucleic acid aptamer sensor obtained in Example 1 is used for the detection of tetracycline, and the steps are as follows:

[0046] 1) Incubate the obtained electrode in different concentrations of tetracycline to be detected (1nmol / L, 5nmol / L, 10nmol / L, 50nmol / L, 100nmol / L, 500nmol / L, 1μmol / L, 5μmol / L) for 50min, and cleaning;

[0047] 2) A tetracycline nucleic acid aptamer-modified electrode was used as a working electrode, a carbon electrode was used as a counter electrode, and an Ag / AgCl electrode was used as a reference electrode to form a three-electrode system. 0 acetate buffer, using differential pulse voltammetry to detect changes in electrochemical signals before and after tetracycline incubation, the potential was set from –0.5V to –0.1V, the pulse width was 0.05V, and the scan rate was 0.5s;

[0048] 3) The differential pulse voltammetry response curves of different concentrations of tetracycline are plotted, and a standard curve is drawn according to t...

Embodiment 3

[0050] The nucleic acid aptamer sensor obtained in Example 1 is used for the detection of tetracycline and other antibiotics, and the steps are as follows:

[0051] 1) Incubate the obtained electrodes in different antibiotic solutions to be tested for 50 min, in which the concentration of tetracycline is 500 nmol / L, meropenem, 7‐aminocephalosporanic acid (7‐ACA), anthramycin, Ampicillin (ampicillin) and gentamycin (gentamycin) concentrations were both 5 μmol / L, and the blank control was ultrapure water, which was washed after incubation;

[0052] 2) A tetracycline nucleic acid aptamer-modified electrode was used as a working electrode, a carbon electrode was used as a counter electrode, and an Ag / AgCl electrode was used as a reference electrode to form a three-electrode system. In 0 acetate buffer, differential pulse voltammetry was used to detect the change of the electrochemical signal before and after incubation of the nucleic acid aptamer sensor. The potential was set from...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A biological sensor for detecting tetracycline on the basis of aptamer specificity comprises a screen-printed electrode of a three-electrode system in an electrolyte. The screen-printed electrode specifically comprises a work electrode, a carbon electrode and an Ag / AgCl electrode. The surface of the work electrode is provided with ferriferrous oxide / reduced graphene oxide-sodium alginate compound layer and a tetracycline aptamer layer. The carbon electrode serves as a counter electrode. The Ag / AgCl electrode serves as a reference electrode. The electrolyte is an acetate buffer solution with thionine as an electrochemical probe. By means of the electro-chemistry signal amplification function of ferriferrous oxide / reduced graphene oxide and the specific binding function of an aptamer to a substrate, tetracycline can be sensitively, accurately and specifically detected. The prepared biological sensor of the aptamer has the advantages of being low in price, simple in preparation method, little in reagent dosage, good in reproducibility and stability and the like. Meanwhile, the method can also be used for detection of other antibiotics, is an electro-chemistry testing method with development potential, and is suitable for quick detection of tetracycline in food safety.

Description

technical field [0001] The invention relates to a technology in the field of food safety, in particular to a biosensor based on nucleic acid aptamer for specific detection of tetracycline and a preparation method thereof. Background technique [0002] Antibiotics are widely used in human medicine and animal breeding to prevent and treat diseases, improve feed utilization and promote animal growth. Tetracycline is a common antibiotic with good broad-spectrum antibacterial properties and is widely used in livestock and poultry farming. my country is a big country in the production and sales of tetracycline antibiotics in the world. The unreasonable use and abuse of antibiotics lead to their drug residues in animal food and the environment. At present, common pathogenic bacteria are seriously resistant to tetracyclines, posing a serious threat to ecosystems and human health. Therefore, it is of great practical significance to study rapid, simple, economical and reliable tetra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N27/48G01N27/30
Inventor 周培詹学佳詹深山初少华徐涵楚
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com