Bacillus dy26-004 and its application in controlling plant pathogenic fungi

A bacillus, plant pathogenic technology, applied in the direction of application, plant growth regulator, and microbial-based methods, can solve the problem of fewer microorganisms, achieve simple fermentation medium, obvious antibacterial effect, and wide antifungal spectrum Effect

Inactive Publication Date: 2018-10-09
THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Most of the microbial strains currently used for biological control come from land, and the screening of land microorganisms over the years has resulted in fewer and fewer microorganisms that have been screened to produce new disease resistance mechanisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus dy26-004 and its application in controlling plant pathogenic fungi
  • Bacillus dy26-004 and its application in controlling plant pathogenic fungi
  • Bacillus dy26-004 and its application in controlling plant pathogenic fungi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Isolation and screening of Bacillus sp. DY26-004

[0025] The present invention relates to Bacillus sp. (Bacillus sp.) DY26-004, which was isolated by the applicant from sediment samples collected during the 26th Oceanic Science Expedition in China. , the bacteria are drop-shaped, light white, and the colonies are large, see figure 1 .

Embodiment 2

[0026] Embodiment 2: Bacillus sp. (Bacillus sp.) DY26-004 strain identification

[0027] Bacillus DY26-004 was identified by 16S rRNA gene sequencing. Universal primers were used to amplify the 16S rDNA sequence of strain DY26-004 from the ocean. The sequence of forward primer 27F was: AGAGTTTGATCCTGGCTCAT, and the sequence of reverse primer 1492R was: ACGGCTACCTTGTTACGACTT. The total DNA of Bacillus spp. DY26-004 was used as the PCR amplification template for PCR reaction. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. The amplified gene was sent to a sequencing company for sequencing. After obtaining the 16S rDNA sequence of the strain, the sequence was compared and analyzed by the National Center for Biotechnology Information (NCBI) and the nucleic acid data in GeneBank (http: / / ncbi.nlm.nih.gov / blast). The results showed that the sequence similarity between DY26-004 16S rDNA sequence a...

Embodiment 3

[0028] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum

[0029] The bacillus DY26-004 obtained in Example 1 was activated on the LB liquid medium, then moved into 50 mL LB culture medium with 1% inoculum, and cultured with shaking at 200 r / min for 2 days at 28 ° C, centrifuged and sterilized by filtration. into a sterile fermentation supernatant for later use. The inhibitory activity of Bacillus DY26-004 against 10 plant pathogenic fungi was determined by filter paper method.

[0030] Use a sterile puncher with a diameter of 6 mm to make the test pathogenic fungi into bacterial blocks, place them in the center of the potato solid medium (PDA) plate, and cultivate them at 28°C for 1 to 2 days, and wait for the test pathogenic fungi to grow. After the filament diffuses and grows, place a number of sterilized double-layer filter paper sheets with a diameter of 6mm around each bacterial block. The filter paper is 0.5-1cm away from the edge of the bac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to bacilli, in particular to a bacillus DY26-004 and application thereof to prevention and control of plant pathogenic fungi. A preservation number of the Bacillus sp.DY26-004 is CCTCC NO:M 2015406. The bacillus DY26-004 has a strong inhibiting effect on various plant pathogenic fungi such as fusaria, colletotrichum musae, paecilomyces variotii, sclerotinia scleotiorum, alternaria longipes, trichoderma viride, rhizoctonia solani, alternaria alternata, botrytis cinerea and colletotrichum gloeosporioides, and has good biological prevention and control effects in pot experiments for prevention and control of sclerotinia scleotiorum and fusarium graminearum, wherein control efficiencies are 72% and 65% respectively. The bacillus DY26-004 which is a nontoxic, non-pathogenic and environment-friendly bacillus is a useful resource for research and development of microbial pesticides and has a potential application prospect.

Description

technical field [0001] The invention relates to bacillus, in particular to a strain of bacillus DY26-004 and its application in the preparation of fermentation supernatant for preventing and controlling plant pathogenic fungi. Background technique [0002] Plant diseases have always been one of the important factors affecting agricultural production. The long-term and extensive use of chemical pesticides has not only led to the resistance of pathogenic bacteria, but also the pesticide residues are harmful to humans, animals and the environment. Biological control is a method of using beneficial organisms or their products to suppress or eliminate harmful organisms. Due to its advantages of non-toxic, non-polluting and not easy to produce drug resistance, it has become a new direction in the research of plant disease control (Calvo et al. al. 2007). Bacteria are widely used in research on plant disease control due to their short growth cycle, easy regulation of metabolism, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/02A01P3/00C12P1/04C12R1/07
Inventor 陈新华吴小君郭文斌
Owner THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap