Method for extracting microorganism total DNA from coal seam water sample

A technology for microorganisms and water samples, applied in the field of molecular biology, can solve the problems of complex physical and chemical properties, unsuitable microbial genomes, and complex composition of coal seam water samples, achieving the effect of good integrity and high purity

Active Publication Date: 2016-07-27
SHANXI UNIV +1
View PDF9 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the complex composition of coal seam water samples, in addition to coal particles, there are also a large number of substances with complex physical and chemical properties in the water samples. At present, there is no method suitable for efficient extraction of microbial genomes in coal seam water samples.
[0003] At present, the total DNA of microorganisms in coal seam water samples is mostly extracted by kit method, but there is no special kit for coal seam water samples. The defect of the wall kit is that the bacterial cells are not completely broken
Similar genome extraction patents have been published, such as the Chinese patent "A Method for Analyzing Microbial Diversity and Species Abundance in Coal Seam Water" (Application No.: 201410186729.2), and the Chinese Patent "A Method for Detection of Microorganisms in Groundwater of Coalbed Gas Fields" (Application No. : 201110005095.2), and the method involving DNA extraction adopts the kit method, while the Chinese patent "DNA Extraction Method of Coal Mine Acidic Mine Underwater Mud" (application number: 200810231369.8), the Chinese patent "A kind of microbial genome DNA and total Method for Simultaneous Extraction of RNA" (Patent No.: CN103642798A), because the nature and composition of the sample are quite different from those of coal seam water samples, the above method is not suitable for the extraction of microbial genomes in coal seam water samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for extracting microorganism total DNA from coal seam water sample
  • Method for extracting microorganism total DNA from coal seam water sample
  • Method for extracting microorganism total DNA from coal seam water sample

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] (1) Take 15mL coal seam water sample and centrifuge at 1500×g for 5min, collect the supernatant in a serum bottle, use suction filtration to collect the microorganisms in the water sample onto the filter membrane, then break the filter membrane into pieces and put them into 5mL STE Buffer (NaCl0.12g, 20mM Tris-HCl10mL, 0.5MEDTA40μL, ddH 2 (09960 μL, to a final volume of 20 mL), transfer to a pre-cooled screw-cap tube containing 0.6 g of glass beads with a diameter of 0.3 mm.

[0031] (2) Break it with a bead mill Mini-BeadBeater (MBB), run it at 2500rpm for 30s, then put the screw cap tube on ice, take the supernatant and transfer it to a new 2mL Ep tube, fill the screw cap tube with STE again, Run at 2500rpm for 30s, let stand on ice, and combine with the first supernatant.

[0032] (3) Add 24 μL of proteinase K (20 mg / mL) and 216 μL of 10% SDS in a 55° C. water bath to continue lysing and digesting the bacteria for 3 h.

[0033](4) Add 1 mL of phenol-chloroform-isoa...

Embodiment 2

[0042] (1) Collection of bacteria: Take 6 mL of coal anaerobic fermentation broth and put them into sterile Ep tubes, and collect the bacteria by filtration with a 0.22 μm membrane. After the membrane is cut into pieces, take a part of the filter membrane and place it in 2mL of STE buffer, move it to a pre-cooled screw cap tube containing about 0.6g of glass beads with a diameter of 0.3mm, and extract the total DNA with the method of the present invention; the other part contains The filter membrane of the bacteria was used as a control to extract the total DNA with a kit from a certain company.

[0043] (2) Break the cells with MBB, the operating program is 2500rpm, 30s, put the screw-cap tube on ice after breaking, take the supernatant and transfer it to a new 2mLEP tube, fill the screw-cap tube with STE buffer again, Run at 2500rpm for 30s, and combine the supernatant with the first supernatant.

[0044] (3) Add 18 μL of proteinase K (20 mg / mL) and 180 μL of 10% SDS in a 5...

Embodiment 3

[0054] Using the genomes extracted in Examples 1 and 2 as templates, the bacterial 16S rDNA gene V1-V3 regions and the archaeal 16S rDNA gene V3-V4 region fragments were respectively amplified for subsequent high-throughput sequencing. The PCR primers were bacterial 27F (AGAGTTTGATCCTGGCTCAG) / 518R (ATTACCGCGGCTGCTGG), the PCR reaction system was 50 μL, including 1 μL of genomic DNA, 5 μL of 10×EasyTaqbuffer, 4 μL of dNTPs (2.5 mM), 2 μL of upstream and downstream primers (10 μM), 1 μL of EasyTaqPloymerase, and ddHO 2 O was added to 50 μL, and the PCR amplification program was pre-denaturation at 95°C for 5 minutes, followed by 30 cycles: 95°C for 30 s, 55°C for 30 s, 72°C for 45 s, and final extension at 72°C for 10 min. The PCR product was detected by 2% agarose gel electrophoresis, and the results were as follows: Figure 4 As shown, because the total DNA quality of the microorganisms extracted by the kit method is general, the situation that the bacterial 16SrDNA fragments ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for extracting microorganism total DNA from a coal seam water sample, belongs to coal seam water sample microorganism analysis and aims to solve the technical problem by providing the method for extracting microorganism total DNA from a coal seam water sample with complex composition. The method comprises the following steps: pretreating the coal seam water sample, centrifugally removing large particulate impurity, and collecting microorganisms in the water sample by means of membrane filtering; breaking microorganism cells, shredding a filter membrane on which microorganisms are collected, resuspending in a buffer solution, breaking cells by means of a ball mill, inoculating for 2-4 h at 55 DEG C with proteinase K and sodium dodecyl sulfate solution until a solution is clear; purifying and precipitating microorganism total DNA, removing miscellaneous proteins by phenol-chloroform process, and adding isopropanol precipitate to collect total DNA. The total DNA extracting method is suitable for coal seam water sample and related samples with complex composition and is good in cell breaking effect, and extracted genome is high in purity and good in completeness and is directly useful in subsequent metagenomics analysis, DGGE analysis and the like.

Description

Technical field: [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method for extracting microbial total DNA from coal seam water samples. Background technique: [0002] Coalbed methane is an unconventional natural gas produced during coal formation, and it is a clean fossil energy. According to the estimate of the International Energy Agency (IEA), the world's coalbed methane resources amount to 263.8×10 12 m 3 , of which my country's coalbed methane resources are about 30×10 12 -36.81×10 12 m 3 , great development potential. The development of coalbed methane can not only improve the situation that coal is the main source of energy in my country and the supply of oil is insufficient, but also contribute to the safe mining of coal mines, reduce greenhouse gas emissions, and improve the atmospheric environment. Coalbed methane can be divided into biogenic gas, thermogenic gas or mixed genetic gas according to its o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12Q1/68
CPCC12N15/1003C12Q1/6806
Inventor杨秀清吴瑞薇聂志强王保玉韩作颖
OwnerSHANXI UNIV